Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Mycobacteriaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium tuberculosis H37Rv
Rv0256c cbtG -336 81.4 CGCTCAACGTGCAAATCCACGCTCTGCATGCCAATATTCTTCCCGTCAGGCGATGACGATGCAGGAAGCCGGTGAGAATCCGGCGCGGTCCCGCCACTGTCACCGGGGAGCGACCCTCGTAAGCCACGGCCACAGGCTGGAAGGCGAGGCAAGCAACGATCCGGGAGCCAGGAGACTCGCGTCATCGCGTCCTGCCACC
Rv1133c metE -305 68.2 GAGAGGGAACCTGGTGAGAATCCGGGACTGTCCCGCAGCGGTATGCAGGAACGACCGCCGTCTTGGAAGTAGACAAGCACTGGTCTCAACGACTGGGAAGCGACGGCCAGTAGGAGCACCCACCGGGTGCGAGCCTGCGAGTCCGAAGACCT
Mycobacterium leprae TN
ML1828 cbtG -298 90.9 TGTACTATATGCGACACTGTGTATCTGTAAAGGCGATGACGATGCAGGAAGTCGGTGCAAAGCCGGCGCGGTCCCGCCACTGTAATCGGGGAGCGACCCTCGTAGGCCACGGCCATTGGCTGGAAGGCGAGGCAAGCGGTGATCCGAGAGCCAGGAAACTCGCGTCATCGCGTCCTGCTAAC
ML0961 metE -392 80.1 TAACCTGAATGATGCAGCTGGTCTGCTGGTTCCGCACCACACGGCGCCAGTATCGAGTGATGCTAGCTCAGCATCGCGAGAGGGAACCCGGTGAGAATCCGGGACTGTCCCGCAGCGGTATGCAGGAACGACCGCCGTCTGGAAGCACTGGTCTTAGAAAAATCCGAGACTGGGAAGCGATGGCCATTAGAAGCACCTATCCAGTGCGCGCCTGCGAGTCCGAAGACCTGCCGGCTGTGTCGGGCGCGCC
Mycobacterium marinum M
MMAR_4328 metE -306 77.3 AAGAGGGAATCCGGTGAGAATCCGGAACTGTCCCGCAGCGGTATGCAGGAACGACCGCCGTCATGAACGAAACAAGCACTGGTCCTTCACGACTGGGAAGCGACGGCCACTAGGAGCACCACCGGGTGCGCGCCTGCGAGTCCGAAGACCTGC
MMAR_2944 cbtG -433 72.2 GTTGTCGGCATCAAGCGGCGGAGGCTTTCGCAGCTTCGTCGTGAGAGGGAACCCGGTGGGAATCCGGGACTGTCCCGCAGCGGTATGCAGGAACGAACACCGTCATCGGCACTGGCCCCACAGCCTGGGACTGGGAAGCGACGGTTAGTAGGAGCACCATCGTCGGTGCGGGCCTGCGAGTCCGAAGACCTGCCAGTTGCGCCGGGCACGTT
MMAR_5098 null -147 24.6 GTTTACACTGGCCGGTGTTGTTTCATTGTTGTTGATGGGCGACGGAATCTGGTGAAATTCCAGAACGGTCGCGCCACTGTCTAGTCAGACCCGGCGCCCGTCATCGGCTACCC
Mycobacterium avium 104
MAV_0557 null -100 19.6 GAATTTGGTGAAACTCCAAAACGGTCGCGCCACTGTCCACAGTCAGACCC
MAV_1329 cbtG -307 77.5 ATGTCACCCGTAAGGTGATGACGATGCAGGAAGCCGGTGCGAATCCGGCGCGGTCCCGCCACTGTCATCGGGGAGCGACCCTCAACGGCCACGGCTGACAAGCTGGAAGGCGAGGCGAGCGGCGATCCGAGAGCCAGGACACTCG
MAV_1262 metE -378 65.6 CATCGAGCGAAGCAACGTTAGTAACGCTTCGTAAGAGGGAACCCGGTGAGAATCCGGGACTGTCCCGCAACGGTATGCAGGAACGACCGCCGTCACCAGCACTGGTCGCAAGACTGGGAAGCGACGGCCACTAGGAACTGCCCGGCTCCTCGGCGGCCCTTCGGGACCGCATCGTCGGCCGGGCACGCACCATCCGGTGCGCGCCTGCGAGTCCGGAGACCTGCCAGCTGTGCCGGGCGCGCC
Mycobacterium sp. JLS
Mjls_5141 null -101 25.1 AGGAATCTGGTGAGAATCCAGAACGGTCGCGCCACTGTGAGAGTCAGAC
Mycobacterium vanbaalenii PYR-1
Mvan_5356 null -101 22.1 CGGAATCTGGTGAGAGTCCAGAACGGTCGCGCCACTGTCAGAGTCAGAC
Mycobacterium flavescens PYR-GCK
Mflv_3882 btuF -170 75.4 GGAAGCCGGTGTGAATCCGGCGCGGTCCCGCCACTGTGACCGGGGAGCGAACCCCACGTCGACCACGGCCGAGAGGCTGGAAGGTCGGGGTGAGCGCTGATCCGGGAGTCAGGATACTGC
Mflv_1431 null -136 26.6 TTGGCTTACGATGCTCGTGTACATCGACGGGTGTCGGAATCTGGTGCAAATCCAGAACGGTCGCGCCACTGTGACAGTCAGACCCGGTTTCCGTCGCACATCTGGTTGGGACGCGAAATCCCGGGAAGGAACCACCATGACCTCACCGCACGCGAGCAGAACCCCCGCAGGAGTCATCGATCTCTCGGC
Mycobacterium smegmatis str. MC2 155
MSMEG_6649 null -292 74.2 TAGGAAGCCGGTGTGAATCCGGCATGGTCCCGCCACTGTGACTGGGGAGCGAACCCCACATCGACCACGGCTTGACGGCTGGAAGGTCGGGGTGAGCACTGATCCAGAAGTCAGGATACT
MSMEG_4561 btuF2 -130 38.5 CAGGGGAATCCGGTGCGAATCCGGAACTGACGCGCAACGGTGAGAGGCTGCCGCCTCGAGTCCGATCACCT
MSMEG_6638 metE -287 75.5 AGTTCCGTGTGCTGTCACAGGTGCGGAACGAGAGGGAACCCGGTGAAAATCCGGGACTGTCCCGCAGCGGTATGCAGGAACGACCGCCGTCATCAGCACTGGCCCCGCCTAGGGGCTGGGAAGCGACGGCCAGTAGGTGTGCGTCAGCGCACGCGCCTGTGAGTCCGAAGACCTGC
MSMEG_6064 btuF -177 46.4 CGTGCGGTATGACACCATCGGTGCCGAAGGCGACTGCGGATCGAGGAAGCCGGTGCGAATCCGGCACGGTCCCGCCACTGTGATCGATGCCCGCGGGGCGTCGAGAGTCAGACACTCACCGCAGTCACCACCTCGCAG
MSMEG_6090 null -105 25.1 CGGAATCTGGTGAGAATCCAGAACGGTCGCGCCACTGTGAAAGTCAGAC
Mycobacterium abscessus ATCC 19977
MAB_0549c btuC3 -325 98.1 ATAGTTTTGGCGCCGCGTTGGTTTCTCCGAAGCACCGAGGAATGCTTCCGGGGATCGCAAGAGGGAATCCGGTGTGAATCCGGAGCTGCCCCGCAGCGGTGAGTGGAAACGACGGCGGCACGTATTGCACTGGGCCCAGGCCCGGGAAGCAGCCGCTGGTAGGTGAGGCGTGCGACGCCTCGTGTCCACGAGTCCGAAGACCTGCCACCGCGGCCGTACCACCA
MAB_4623c metE -350 85.7 GCCGTTGTCAGCATCGAGTGGCGGGCCCTACGGGGGCCGGCACAAGAGGGAACCCGGTGAGAATCCGGGACTGTCCCGCAGCGGTATGCAGGAACGATCGCCGTCATAAGCACTGGGAATGCCACCAACGCTCCTGGGAAGCGACGGCCCGTAGGAAAACCTGAGCCCGGGTAATGCCTGTAAGTCCGAAGACCTGCCAGTTGTGTCGGATGCGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD