Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Mycobacteriaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium tuberculosis H37Rv
Rv1832 gcvB -167 38.9 ACGATGCCTCTGGAAAGCGGTGGCGACCCCTGGCGGTCCTCACCCGCCGATGGGGAAAGGCGATTCACCTGACGGTGGACAGAGTCGCCGAATCTCTCAGGCGCCTGGCGTGCAGGTGAAGACAGAGGGAGAGGGCC
Rv0070c glyA2 -399 50.5 CTGACGCGATGTGGGAGAACCTCCATGTCGAGGCGCCGTAGGAGCAATCTCCTCCCCGAGAATCTCTCAGGCCCAAGCACCACACCGC
Rv1832 gcvB -263 53.7 GCTCTAGTGCGGGAGAGTTCTGTGGCTGCCAGCTACGGACGCCGAAGGAGCAATACCTCTCCGTCAACCTCTCAGGCACCCGGACCGCGCGAGAC
Rv0070c glyA2 -312 31.3 CCGAGGCAACTCTGGAGACAGGGACGGTCGCACCGACCGTGCCTGACCGAAGGTGTAGAGCGGCGCCATGATGCGACGCCGCAGACTCTCAGGTTTCAGGACAGAGCGGGGAGG
Mycobacterium marinum M
MMAR_2708 gcvB -289 55.8 GTTCTCGTGCGGGAGAGTTCTGTGGCCGCCAGCTACGGACGCCGAAGGAGCAACACCTCTCCGTCAATCTCTCAGGCCCCCGGACCGCGCTGGATGACG
MMAR_0211 gcvB -253 55.7 TTGACGCGACGCGGGAGAAACCTCGCTATCGAGGCGCCGTAGGAGCAATCTCCTCCCCGAGAATCTCTCAGGCCCCAGTACCGCATCGC
MMAR_2708 gcvB -189 27.8 TGCCTCTGGAAAGCGGTGGTGACCCGTAGCGGTCCTCGCCCGCCGATGGGGAAAGGCGCCCGCTTGGGCTGGGCGCTGAATCTCTCAGGCGCCTGGTGCACGGGTGAAGACAGAGGGAGAGGGCC
MMAR_0211 gcvB -165 36.1 CCGAGGCGACTCTGGAGACAAGGATCGGTCACCTAGACCGTGCCTTACCGAAGGTGTACGACGTCGCTGTAATGGCGGCGCCACAGACTCTCAGGTTTCAGGACAGAGCGGGGAGG
Mycobacterium avium 104
MAV_2884 gcvB -275 52 TCGCATTCGAGCGGGAGAGTTCCGTGACGGCCAGTCACGGACGCCGAAGGAGCAACACCTCTCCGTCAACCTCTCAGGCACCCGGACCGCACGAA
MAV_2884 gcvB -180 32.2 ACATGATGCCTCTGGAAAGCGGTGCCGGCCTTCGGGCCCGCACCCGCCGATGGGGAAAGGCGGCCGCGACAGCATCGGCCGCCGAATCTCTCAGGCGCCCGGCGAACGGGTGAAGACAGAGGGAGAGGA
Mycobacterium sp. JLS
Mjls_2871 gcvB -267 45.1 TCGCCCGTGTGCGGGAGAGCTCCGTGATCGCCAGTCACGGGCGCCGAAGGAGCAACACCTCTCCGTCAACCTCTCAGGCACCCAGGACCGCGCACG
Mjls_2871 gcvB -170 23.8 CCTCGATGCCTCTGGAAAGCGGTGGACACCAGTGGTCCGCCCGCCCATGGGGAAAGGCGCGCCCGGCGAGCTGTTCGGACGCGGCCGAATCTCTCAGGCGCCCGCCCCGGGTCGACGACAGAGGGAGAGGG
Mycobacterium vanbaalenii PYR-1
Mvan_3131 gcvB -141 34.3 CCCCGATGCCTCTGGAAAGTGGTGTGTTGGCACCCGCCCATGGGGAAAGGCCCAGCCGGCCGAAACTCTCAGGCAGCCCGGACCGGGTCGACGACAGAGGGGGAGGA
Mvan_3131 gcvB -238 46.7 ATCGCCCTGTGCGGGAGAGTTCCGTTGCCGCCAGCCACGGACGCCGAAGGAGCAATACCTCTCCGTCAACCTCTCAGGCACCCAGGACCGCGCCAG
Mycobacterium flavescens PYR-GCK
Mflv_3398 gcvB -160 22.4 CCCCGATGCCTCTGGAAAGCGGTGCACCGCACCCGCCCATGGGGAAAGGTCCCGCTCGCCGGCGTGCGTCGCGAACCGAATCTCTCAGGCAGCCCCGAACGGGCCGACGACAGAGGGGGAGGG
Mflv_3398 gcvB -257 43.3 TCGCCCTTGCGCGGGAGAGTTTCGTGGCCGCCAGCCACGGACGCCGAAGGAGCAACACCTCTCCGTCAACCTCTCAGGCACCCAGGACCGCGCCGG
Mycobacterium smegmatis str. MC2 155
MSMEG_3642 gcvB -284 50.3 ATCGACCTGTGCGGGAGAGTTCCGTGATCGCCAGTCACGGGCGCCGAAGGAGCAACACCTCTCCGTCAACCTCTCAGGCACCCAGGACCGCACCAG
MSMEG_3642 gcvB -187 31.4 CCACGATGCCTCTGGAAAGCGGCGCCGGCAGGCGCCCGCCCATGGGGAAAGGCTCGCACGGTCGTGGGCCGAATCTCTCAGGCGCCCGATCGGGTCGACGACAGAGGGAGAGGG
Mycobacterium abscessus ATCC 19977
MAB_2407 gcvB -12 44.7 CGGGAGAGTGTCATGACGGCCAGTCATGACCGCCGAAGGAGCAACACCTCTCCGTCAATCTCTCAGGCCCCCGAACCGCCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD