Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Mycobacteriaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium abscessus ATCC 19977
MAB_3877c rplJ -235 16.7 GTAACCTAATCCAGCTCCACCGAAGACCGTCGGTCACCTCGTCAGAGGTTGAAGGTTCAGGATTCGTCCTGACGGCCCACGCAGGAGGACGAGGTACGACCTGTGGATCAAAAGTCCGTAGTTCTTCACGCCCCGACCTGTCTGCGTCGGGGCGTTTGTCGTTTCAGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD