Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Deinococcus-Thermus

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus geothermalis DSM 11300
Dgeo_0640 rplJ -118 22.2 CACCTTTCCAATTTCGGCATCGTAGACAGCGGGGACCCTTGCCAGGTTTAAACATCCCGCCGAGTTGTCAGGGCGCGAGTGCGCACCTGGACTTGTTCACCACCAGA
Deinococcus deserti VCD115
Deide_06060 rplJ -120 20.5 ATAGGCCCCAATTCCGGCACCCAAGACAGCGGGGACCCTTGCCAGGTTTAAACATCCCGCCGAGTTGCCAGGCTGCGAATGTGCACCTGGACTTGTTCACCAGCAAA
Thermus thermophilus HB27
TTC1777 rplJ -123 21.5 GCCAAAGACAGCGGGGGGCCTTCGGGCCTTAAAAAGCCCGCCGAGGCGCTTGAGGGGGAGCGTTTCCTCGGAAAT
Thermus aquaticus Y51MC23
TaqDRAFT_4672 rplJ -115 25.5 CAAAGACAGCGGGGGGCTCAGGCCTTAAACATCCCGCCGAGGCGCTTGAGGGGGAGCGTTTCGCAAAATCCCAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD