Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Deinococcus-Thermus

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus radiodurans R1
DRB0007 btuF -100 13.8 GGGGAAGCCCGGTGACGGTGCGGCCTGGCTTTTTCCAGTCCCGCACCCATTCCGGCACTGTCGCGCAGCGGTGAATCGGCCTTAAGGGCCGTCAGTCCGAATGCCTCT
DR2588 btuF -84 17.6 GGGAAAGTCCGGTTTCAGTCCGGCACTGTCGCGCAACGGTTTTCAGTCCGAACACCTCG
Deinococcus geothermalis DSM 11300
Dgeo_0025 btuF -244 21.6 GGGAAAGACCGGTGAGAATCCGGCACTGTCGCGCAACGGTCACTGCCCCCTCTGTCCACCCCCAAGACAAGGGGCGGGAAGTCCGAACACC
Dgeo_2363 btuF -259 35 CCGGCTTCTGCTATCCTGGCGCCACCTGGGAGCGGGGAAGTCCGGTGAGAATCCGGCGCTGTCGCGCAACGGTAAGCAGGCCTGCAGTCCTGTCAAGCCCGAATGCCCCCCAGGGACGCCCTGCGCTGCAG
Deinococcus deserti VCD115
Deide_02140 btuF -274 25.5 GGAAGCAGGTGAAGACCCCTGCCGGGGGTCCATTCCTGCACTGTCGCGCAACGGTAAACGCTGGCCCTTTGAGGCCGGCGCAAAGTCCGAACACCGG
Deide_2p01550 btuF -242 41.2 GGAAGTCCGGTGAGATTCCGGCGCTGTCGCGCAACGGTATGCAGGCCCTGACCTGCGAGCCCGAATACCAC
Thermus thermophilus HB27
TTP0007 hoxN -209 45.9 AGGGGGAAGACCGGTGAAAGTCCGGCGCTGTGCCGCAACGGTAACCGGCCCTAAGCCACAGGCCTAGCGTCTTGGCCGGAAGCCCGGATACCCGC
TTC0390 btuF -291 60.5 CCAGGTCCCGTAGCCCTGGTGCCTGGGCGCGTAGTCCAGGCTTAAAGTGGGGAAGTCCGGTGCAAGTCCGGCGCTGTCCCGCAACGGTAACCGGTCACGCGTCAGGCCCTTCGTCGCAGGCCGGAAGCCCGAATACCTGCCAGGGCCGTCCGCCCTTCCCC
TTP0160 achX -240 35.6 GGAAGTCCGGTGAAAGTCCGGCGCTGTCCCGCAACGGTAACCGGCCCAAGCGTCGCGCCCTCCGCCCTGGCCGGAAGCCCGAGTACCCG
Thermus aquaticus Y51MC23
TaqDRAFT_5534 btuF -291 55.7 CAGGTCCCGTTTGCCCTGGTGCCTGGGCGCGTAGTCCAGGCTTAAAGTGGGGAAGTCCGGTGCAAGTCCGGCGCTGTCCCGCAACGGTAACCGGTCCCGCTTCGTGCCCTTCAACGCAGACCGGAAGCCCGAATGCCTGCCAGGGCCGCCCGCCTTTCCCC
TaqDRAFT_5285 hoxN -204 42.1 AAAGGGGGAAGACCGGTGAGAGTCCGGCGCTGTGCCGCAACGGTAACCGGCCCAACCCATAGGCCCATCGTCTAGGCCGGAAGCCCGAATACCC
TaqDRAFT_3194 achX -260 37.4 GGAAGTCCGGTGCAAGTCCGGCGCTGTCCCGCAACGGTAACCGGCCGCTTTGGGGCCCCTGGCCCAAAGGAACCCCAGGCCGGAAGCCCGAGTACCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD