Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Deinococcus-Thermus

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus deserti VCD115
Deide_1p01370 Deide_1p01370 -91 47.6 ACACCGAAAAAGGCAAACCCGTCGCGAGGCGGGGACGCAAAGCTCCCGGGACCCCTGAGGTCGGCCGAGCTACCGAA
Deide_1p00130 licB -257 46 AAACCGAAAAAGGCAAATCCGCCGCGAGACGGAGACGCAAAGCTACCGGGACCCACGAGGTCGGCCGAGTTACCGAA
Deide_1p01250 licB -205 46 AAACCGAAAAAGGCAAATCCGCCGCGAGACGGAGACGCAAAGCTACCGGGACCCACGAGGTCGGCCGAGTTACCGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD