Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Deinococcus-Thermus

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus radiodurans R1
DR0153 ribD -184 78.3 ACCTCTTTCGGGGCGGGGCGAAATTCCCCACCGGCGGTAAGTTCTCCCGAACAAGCCCGCGAAGCCCGCGCAAACCGCACCACGCGCCGGGCCCGATGCCGCGCAACTCGGCAGCCGACGGTCACAGTCCGGACGAAAGAAGGAGGAGAC
Deinococcus geothermalis DSM 11300
Dgeo_0300 ribD -188 87.5 GCTTCCTTCGGGGCGGGGTGAAATTCCCCACCGGCGGTGATCCGGCTCTGGCCGGTCAGCCCGCGAAGCCCGCGCAAACTGCACCACGCGCGAGGCCCGACTCCGTGCGATTCGGAGGCCGACGGTCACAGTCCGGATGAGAGAAGGAGGAACG
Deinococcus deserti VCD115
Deide_02270 ribD -306 27.6 CAGCTTCCTTCGGGGCGGGGTGAGATTCCCCACCGGCGGTGATGGTGATTCCGGAACCTGCGCCAGATGCCAGTCCAGAATGACCTC
Thermus thermophilus HB27
TTC0699 ribD -126 98.5 GCACCTCCTTCGGGGCGGGGTGGAAGTCCCCACCGGCGGTGAAAGCCCGCGAAGCCCCTAAAGGGGCCCGACCCGGTGGAATTCCGGGGCCGACGGTGAAAGTCCGGATGGGAGAAGGAGGGC
Thermus aquaticus Y51MC23
TaqDRAFT_3862 ribD -122 93 ACCTCCTTCGGGGCGGGGTGGAAGTCCCCACCGGCGGTGAAAGCCCGCGAAGCCCCTCTGGGGCCCGACCCGGTGGAACTCCGGGGCCGACGGTGAAAGTCCGGATGGGAGAAGGAGGGCGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD