Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Rhodobacterales

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Paracoccus denitrificans PD1222
Pden_4799 paaF -74 6.6 ATTGACCGGCCGGTCGGTTTAT
paaZ2 paaZ2 -20 6.6 ATAAACCGACCGGCCGGTCAAT
Pden_4811 paaJ -61 6 ATTGACCAATCGGTCGGTGAAT
Pden_4813 null -74 5.9 ATTGACCGACCGAACGGTTAAC
Rhodobacterales bacterium HTCC2654
RB2654_06379 paaF -54 6.1 ATTGACCGACCAGTCGGTTTAA
RB2654_06384 paaZ -66 6.1 TTAAACCGACTGGTCGGTCAAT
Silicibacter TM1040
TM1040_0438 paaF -78 6.7 ATTGACCGTCCGGTCGGTTTAT
TM1040_0437 paaZ -104 6.7 ATAAACCGACCGGACGGTCAAT
Silicibacter pomeroyi DSS-3
SPO0739 paaG -63 6.4 ATAAACCGAACGGTTGGTCAAT
SPO0740 paaF -61 6.4 ATTGACCAACCGTTCGGTTTAT
SPO0735 paaZ -90 5.4 ATTGACCGACCGTTCGGTCGCG
Roseobacter sp. MED193
MED193_17304 paaZ -114 6.7 ATAAACCGACCGGACGGTCAAT
MED193_17309 paaF -95 6.7 ATTGACCGTCCGGTCGGTTTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD