Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Rhizobiales

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodopseudomonas palustris CGA009
RPA4019 livK -144 6.3 ATTGACCGACCGTTCGGTTAAG
RPA1724 paaY -138 5.7 ATTGACTGACCGATCGTTCAAT
RPA3768 paaA -53 5.9 ATTGACCGTCCAATTGGTCAAT
RPA1725 paaZ -108 5.7 ATTGAACGATCGGTCAGTCAAT
RPA3769 paaR -91 5.9 ATTGACCAATTGGACGGTCAAT
Rhizobium sp. NGR234
NGR_c26200 blr2890 -53 5.7 TCTGACCGATCGGTCGGTTAAT
NGR_c26090 paaF -70 6.5 ATTGACTGACCGGTCGGTTTAT
NGR_c26080 paaG -51 6.5 ATAAACCGACCGGTCAGTCAAT
Xanthobacter autotrophicus Py2
Xaut_0903 paaF -60 6.2 ATTAACCGATCGATCGGTTAAT
Xaut_0904 paaZ -166 6.2 ATTAACCGATCGATCGGTTAAT
Xaut_0894 paaR -118 6.7 ATTGACCGACCGGATGGTCAAT
Xaut_0893 livK -175 5.3 ATTGTCCGTCTGGTCGATCAAT
Xaut_0893 livK -117 6.7 ATTGACCATCCGGTCGGTCAAT
Xaut_0894 paaR -60 5.3 ATTGATCGACCAGACGGACAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD