Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Comamonadaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Delftia acidovorans SPH-1
Daci_0809 paaK -59 5.7 TCCTACCGTCCGGTCGGTCAAT
Daci_0809 paaK -63 4.6 ATAATCCTACCGTCCGGTCGGT
Daci_0568 paaF -71 5.2 ATTTACCGACCATTCGGTAAAT
Daci_0808 paaZ -111 6 ATTGACCGACCGGACGGTAGGA
Leptothrix cholodnii SP-6
Lcho_2406 paaY2 -115 5.5 CTTGACCGACCGGTAGGTAAAT
Lcho_3574 paaA -48 6.3 ATTTACCGACCGGACGGTCAAT
Lcho_2405 paaF -42 5.8 ATTTACCTACCGGTCGGTCAAG
Methylibium petroleiphilum PM1
Mpe_A0984 paaF -85 5.7 GTCTACCGACTGGTCGGTCAAT
Mpe_A0983 paaY2 -78 5.6 ATTGACCGACCAGTCGGTAGAC
Variovorax paradoxus S110
Vapar_1238 paaF -48 5.5 ATCTACCGGACGGTCGGTCAAT
Vapar_1239 paaY2 -101 5.4 ATTGACCGACCGTCCGGTAGAT
Vapar_1238 paaF -52 4.6 TAAAATCTACCGGACGGTCGGT
Verminephrobacter eiseniae EF01-2
Veis_3942 paaF -102 5.5 ATCTACCGCACGGTCGGTCAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD