Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GutR in Bacillales

Properties
Regulator family: GutR
Regulation mode: activator
Biological process: Sorbitol utilization
Effector: Sorbitol
Regulog: GutR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus amyloliquefaciens FZB42
RBAM_006540 gutB -140 6.8 TAAAAAGTACAGTGCGGCTGTCCTTTTAT
RBAM_006530 gutR -89 6.8 ATAAAAGGACAGCCGCACTGTACTTTTTA
Bacillus subtilis subsp. subtilis str. 168
BSU06150 gutB -142 7.3 ATAAAAGTACAGTGCCGCTGTCCTTTTAT
BSU06140 gutR -88 7.3 ATAAAAGGACAGCGGCACTGTACTTTTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD