Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Streptococcaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_2529 dnaJ -108 7.9 TTAGCACTCTGATAAAAAGAGTGCTAA
LACR_1025 hrcA -61 7 TTAGCACTTAGAGGTAAAGAGTGCTAA
LACR_1025 hrcA -141 8.1 TTAGCACTCTAATAAAAAGAGTGCTAA
LACR_0439 groS -51 7.1 TTAGCACACAACTATTAAGAGTGCTAA
Lactococcus lactis subsp. lactis Il1403
L198515 groS -52 7.9 TTAGCACTCGTTTAATAAGAGTGCTAA
L0272 dnaJ -108 8.1 TTAGCACTCTTATAAAAAGAGTGCTAA
L0212 hrcA -134 6.7 TTAGCACTTAGAGATGAAGAGTGCTAA
L0212 hrcA -214 7.8 TTAGCACTCTACCAAAAAGAGTGCTAA
Streptococcus agalactiae 2603V/R
SAG2075 groS -64 7.5 TTAGCACTCTCTGTATAAGAGTGCTAA
SAG0488 clpL -143 6.9 TTAGCACTCTAATATATTCAGTGCTAA
SAG0095 hrcA -58 7.2 TTAGCAGTCGATGTGTAAGAGTGCTAA
SAG0095 hrcA -140 7.9 TTAGCACTCTTTGAATAAGAGTGCTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_2041 groS -61 7.7 TTAGCACTCGTACAACAAGAGTGCTAA
SDEG_1830 hrcA -47 7.1 TTAGCAGTCAGATACATAGAGTGCTAA
SDEG_1496 clpL -141 6.1 TTATCACTCTATCCCTGACAGTGCTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0145 groS -65 7.7 TTAGCACTCATAAAACAAGAGTGCTAA
Sez_0605 clpL -141 5.9 TTATCACTCTATACTGGATAGTGCTAA
Sez_0400 hrcA -48 6.9 TTAGCAGTCCGATGTATAGAGTGCTAA
Streptococcus gallolyticus UCN34
GALLO_0124 groS -86 7.5 TTAGCACTCGATGTATTAGAGTGCTAA
GALLO_0241 hrcA -47 7.1 TTAGCAGTCGAGGTATATGAGTGCTAA
GALLO_0241 hrcA -130 8 TTAGCACTCTACTAAAAAGAGTGCTAA
GALLO_0612 clpL -144 7.1 ATAGCACTCTTAGCATAAGAGTGCTAA
Streptococcus gordonii str. Challis substr. CH1
SGO_0400 hrcA -59 6.3 TTAGCACTCAAAGTGGTCGAGTGCTAA
SGO_0400 hrcA -142 7.9 TTAGCACTCTTGCAAAAAGAGTGCTAA
SGO_1886 groS -50 7.3 TTAGCACTCGATAGACGAGAGTGCTAA
Streptococcus mitis B6
smi_0481 groS -57 7.7 TTAGCACTCATCTATAAAGAGTGCTAA
smi_0353 hrcA -53 6.5 TTAGCACTTGAGTGCATCGAGTGCTAA
smi_0353 hrcA -136 7.5 TTAGCACTCTTGATGAAAGAGTGCTAA
Streptococcus mutans UA159
SMU.1955 groS -46 7 TTAGCACTCAGTATATTGGAGTGCTAA
SMU.80 hrcA -59 7.2 TTAGCAGTCGTCTGTTAAGAGTGCTAA
SMU.80 hrcA -143 7.5 TTAGCACTCAAGCAGAAAGAGTGCTAA
Streptococcus pneumoniae TIGR4
SP_0515 hrcA -53 6.5 TTAGCACTTGGATGCATTGAGTGCTAA
SP_1907 groS -57 7.6 TTAGCACTCAAGTTCAAAGAGTGCTAA
SP_0515 hrcA -136 7.8 TTAGCACTCTTGATAAAAGAGTGCTAA
Streptococcus pyogenes M1 GAS
SPy2072 groS -62 7.1 TTAGCCCTCGATGAACATGAGTGCTAA
SPy1763 hrcA -48 7.6 TTAGCAGTCTACTAAATAGAGTGCTAA
SPy1763 hrcA -132 7.4 TTAGCGCTCTTTATAAAAGAGTGCTAA
Streptococcus sanguinis SK36
SSA_0225 groS -51 7.3 TTAGCACTCGATAGTTTAGAGTGCTAA
SSA_2009 hrcA -142 8 TTAGCACTCTTGTAAAAAGAGTGCTAA
SSA_2009 hrcA -59 7 TTAGCACTCGAGGTGATTGAGTGCTAA
Streptococcus suis 05ZYH33
SSU05_0298 hrcA -140 7.4 TTAGCACTCGATATCATAGAGTGCTAA
SSU05_0298 hrcA -226 7.8 TTAGCACTCTAAGCAAAAGAGTGCTAA
SSU05_0147 groS -20 7.7 TTAGCACTCGAATACAAAGAGTGCTAA
Streptococcus thermophilus CNRZ1066
str0203 groS -79 6.4 TTAGCAGTTGTCTATCGTGAGTGCTAA
str0118 hrcA -49 7.2 TTAGCAGTCGTTGTACGAGAGTGCTAA
str0118 hrcA -137 8 TTAGCACTCTTTCAAAAAGAGTGCTAA
Streptococcus uberis 0140J
SUB1742 groS -63 7.5 TTGGCACTCTTTTTTAAAGAGTGCTAA
SUB1281 clpL -140 6 TTATCACTCTAAGTCACTAAGTGCTAA
SUB1506 hrcA -45 7.1 TTAGCAGTCTTAGCATCAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD