Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cg1831 in Corynebacteriaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector:
Regulog: Cg1831 - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium efficiens YS-314
CE2677 cg1832 -34 5.9 AGTCAAACGGGTGATTGAGT
CE2678 cg1831 8 5.9 ACTCAATCACCCGTTTGACT
Corynebacterium glutamicum ATCC 13032
cg1832 cg1832 -34 6.5 AGTCAAATGATCATTTGAGT
cg1831 cg1831 -40 6.5 ACTCAAATGATCATTTGACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD