Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Lactobacillaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_0331 mntH -213 4.3 ATTTTTGGTAAGCCAAAAAT
LVIS_0225 mntH -19 5 AAGGAAGGGAGTCTTAAAAT
Lactobacillus casei ATCC 334
LSEI_2423 mntC -32 5.7 GAATTAGGTCACCCTAAAAA
LSEI_2413 mntH -71 6.4 AAGTTAGGGAGACCTAAAAG
Lactobacillus fermentum IFO 3956
LAF_1828 mntH -91 4.8 TTTTTATGCTAACCTAACAA
Lactobacillus plantarum WCFS1
lp_1095 mntC -82 5.2 AAGTTAACTGCACCTAACAA
lp_2992 mntH -98 5.3 TTTGTAGGCATACCTAAAAA
Lactobacillus reuteri JCM 1112
LAR_1743 mntH -89 4.8 TTTTTATGTTACCCTAACAA
Lactobacillus rhamnosus GG
LGG_02411 mntH -72 6.4 AAGTTAGGGAGACCTAAAAG
LGG_02421 mntC -31 5.6 GAATTAGGTCACCCTAAAAT
Lactobacillus sakei subsp. sakei 23K
LSA0180 mntC -34 6.3 AAGTTAGGTATACCTAAAAG
LSA1699 mntH -77 5.8 AAGTTAGGGCATCCTAAAAT
LSA0246 mntH 7 5.5 AAGTTAAGGGACCCAAAAAG
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0904 mntH -87 5.2 AGTTAAGGTAGACCTAAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD