Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CitB in Corynebacteriaceae

Properties
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Regulog: CitB - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium efficiens YS-314
CE2906 citH -35 6 GAACTAAATGCACTTAATTC
CE2905 citA -81 5.8 GAATTAAGTGCATTTAGTTC
Corynebacterium glutamicum ATCC 13032
cg3127 tctC -43 5.1 GAGCTTGTTGTCCAAAAGTC
cg0089 citA -80 5.2 GACTTTTGTGCATTATGATC
cg0088 citH -148 5.7 GATCATAATGCACAAAAGTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD