Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR in Corynebacteriaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium aurimucosum ATCC 700975
cauri_1870 arsR -56 6.1 GTATTGATGCGCGTCAATAT
cauri_1869 arsB -77 6.1 ATATTGACGCGCATCAATAC
Corynebacterium efficiens YS-314
CE0874 arsR 30 5.9 GTATTGATTGTTATCAATAT
CE0875 arsB -36 5.9 ATATTGATAACAATCAATAC
CE0874 arsR 64 6.4 ATATTGATGACTGTCAATAT
CE0875 arsB -70 6.4 ATATTGACAGTCATCAATAT
Corynebacterium glutamicum ATCC 13032
cg0318 arsB -69 5.8 ATATAGACGCACATCGATAT
cg0318 arsB -36 5.6 ATATCGGCAAACATCAATAT
cg1705 arsB -69 6.1 ATATTGACGAATGTCGATAT
cg1705 arsB -35 6.2 ATATCGACAGGTATCAATAT
cg0317 arsR -65 5.6 ATATTGATGTTTGCCGATAT
cg0317 arsR -32 5.8 ATATCGATGTGCGTCTATAT
cg1704 arsR -65 6.2 ATATTGATACCTGTCGATAT
cg1704 arsR -31 6.1 ATATCGACATTCGTCAATAT
Corynebacterium jeikeium K411
jk2006 arsR -59 6.4 ATATTGATGCCTGTCAATAT
jk2006 arsR -32 6.3 ATATTGATATCTGTCAATAT
jk2005 arsB -94 6.3 ATATTGACAGATATCAATAT
jk2005 arsB -67 6.4 ATATTGACAGGCATCAATAT
Corynebacterium urealyticum DSM 7109
cur_0030 arsR -66 6 ATATTGATGGTCATCGATAC
cur_0030 arsR -32 6.1 ATATAGATGACCGTCAATAT
cur_0031 arsB -68 6.1 ATATTGACGGTCATCTATAT
cur_0031 arsB -34 6 GTATCGATGACCATCAATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD