Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Corynebacteriaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium amycolatum SK46
CORAM0001_1328 groL2 -249 6.2 CTTGCACTCGATGGGGTTGAGTGCTAG
CORAM0001_0268 groS -154 6 TTAGCGCTCACTATGGTTGAGTGTTAG
CORAM0001_0268 groS -131 5.8 TTAGCACTTGCAGGGGTAGAGTGCTAA
CORAM0001_1328 groL2 -213 7.2 TTAGCACTTGCTCTAATTGAGTGCTAA
Corynebacterium aurimucosum ATCC 700975
cauri_0474 groS -144 5.5 CTAGCAGTCGCGAGGGTAGAGTGCTAG
cauri_2263 groL2 -184 5.1 CTTGCAGTCGGTAGGCCTGAGTGCCAG
cauri_2263 groL2 -149 5.2 CTAGCACTTCCACATGGCAAGTGCCAG
Corynebacterium diphtheriae NCTC 13129
DIP2020 groL2 -218 6 CTTGCACTCGTACCCGTAGACTGCTAA
DIP2020 groL2 -184 7.1 TTAGCACTCGATCTAACCGAGTGCTAA
DIP0575 groS -124 5.2 CTGGCACTCTCAGGGGTAGAGTGCCAG
Corynebacterium efficiens YS-314
CE0601 groS -134 5.3 TTAGCACCCTTAGCGGTTGAGTGCTGG
CE2561 groL2 -182 6.7 CTTGCACTCGACATGGGCGAGTGCTAG
CE2561 groL2 -148 5.7 TTAGCACTTACCTCGTATGAGTGCCAG
Corynebacterium glutamicum ATCC 13032
cg3011 groL2 -148 5.2 TTAGCACTCAACTAATCAGAGTGCCAA
cg3011 groL2 -183 7 CTTGCACTCACACCCCTTGAGTGCTAG
cg0690 groS -147 5.9 TTAGCACCCTCAACAGTTGAGTGCTGG
Corynebacterium jeikeium K411
jk0267 groL2 -181 5 CTTGCAGTCGATGGGGGAGAGTGCTAA
jk0267 groL2 -146 6 TTAGCACTTGAAGTAAGGGAGTGCCAG
jk1729 groS -145 5.7 TTAGCACTTGCGAGGGTAGAGTGCCAG
Corynebacterium kroppenstedtii DSM 44385
ckrop_1667 groL2 -184 5.4 CTTGCACTCTAAGCCCGAGACTGCTAA
ckrop_1737 groS -129 5.7 CTGGCACTCACACGGGTAGAGTGCCAA
ckrop_1737 groS -152 5.2 TTAGCACTCCCGGTGGTTGAGAGCTGG
Corynebacterium urealyticum DSM 7109
cur_1716 groL2 -183 5.2 CTTGCACTCAAGGGGTGCGAGTGCTAA
cur_1716 groL2 -148 7 TTAGCACTTGCACTGGTTGAGTGCCAG
cur_0393 groS -11 5.3 TTAGCACTTGGGTGGGTAGAGTGCTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD