Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AmtR in Corynebacteriaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium aurimucosum ATCC 700975
cauri_1607 gdh -86 5.1 AATTTAGGTCGATTGATAGAAAAC
Corynebacterium diphtheriae NCTC 13129
DIP0956 cg2181 -162 4 TAAAACTATTATTTGATAGTTTTA
DIP1547 gdh -156 5.3 ACTTTCGATAGTTCAATAGGAATT
DIP1644 glnA -117 5.4 TTTTTTGATAGCTCTATAGATAAT
Corynebacterium efficiens YS-314
CE1701 amtA -99 5.3 TTAAACTATTGACCGATAGAAACA
CE1701 amtA -65 5.1 GTTATCTGTTATGCAATAGAAAAT
CE0715 amt1 -102 5.6 ATTATCGGTCGATCTATAGATAAA
CE0993 ureA -25 4.7 TCTAACTATTGACTTATAGTTATT
CE0157 hkm -46 5.7 ATTTTCGATCAACCTATAGGAAAA
CE1000 urtA -39 5.1 TAAACCTGTCGATCTATAGAAATC
CE1000 urtA -65 5.6 ATTACCTATAGCTTTATAGAAACA
CE0158 gltB -107 5.4 TTTTCCTATAGGTTGATCGAAAAT
CE0158 gltB -40 5.1 ATTATCGAATGATTAATAGAAACC
CE0711 uctT -117 5.9 ATTACCTATCGATCGATAGATAAA
CE1982 gdh -47 4.6 TAAAACTATTAACCGTTAGGTATA
CE1968 amtB -168 5.3 GAATTCTATCGACCTATCGAAAGT
CE2104 glnA -147 5.5 AGTTTTGATAGATCGACAGATAAT
CE2850 crnT -72 5.3 TAATTCTATAGATCAATAGAATTA
CE2850 crnT -27 5.7 AGTTTCTATCACTCAATAGAAAAG
CE0157 hkm -113 5.1 GGTTTCTATTAATCATTCGATAAT
CE1844 gluA -110 4.9 TTTACCTATTGAGCTATTGATAAA
Corynebacterium glutamicum ATCC 13032
cg2261 amtB -140 5 CTATTCTATAGATCTATTGAAATT
cg2261 amtB -183 5.4 ATTACCTGTTAAACTATAGAAAAT
cg1785 amtA -100 5.2 GAAATCTATAGAACGATAGGTAAA
cg1785 amtA -64 5.3 TTTATCTATAGCGGAATAGAAAAT
cg0113 ureA -31 4.8 AATTTCTGTTACCTGACAGAAAGG
cg0228 hkm -179 5.4 TGTTTCTATCAATCGTTCGATAAT
cg1296 cg1296 -41 6 ATTTTCTATCAATCTATAGATACT
cg2181 cg2181 -218 5.7 AATTTCTATCAAACTATAGAAAGA
cg1295 cg1295 -40 6.2 AGTATCTATAGATTGATAGAAAAT
cg1061 urtA -68 5.1 ACTACCTATAGGCTGACAGAAACT
cg1061 urtA -42 5.5 AAAAACTATAGAGCTATAGAAACT
cg0229 gltB -46 5.5 ATTATCGAACGATTGATAGAAACA
cg0229 gltB -115 5.3 TTTTCCTATAGGTTGATCGAAAGT
cg0228 hkm -110 5.5 ACTTTCGATCAACCTATAGGAAAA
cg2280 gdh -209 4 TAAAACTATTAACCGTTAGTATGA
cg2280 gdh -367 4.9 AAAATTGATAAACCTAAAGAAATT
cg0104 codA -60 4.9 AATACCTGTCAAGCAATAGAATAG
cg2429 glnA -149 5.2 AGTTTTGATAGATCGACAGGTAAT
cg0103 crnT -79 5.7 CATTTCTATCAATCTATAGAAAGT
cg0103 crnT -33 6 AGTTTCTATAGATTGATAGAAAAG
cg2136 gluA -193 5.2 AATATCTATCATGTGATAGGTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD