Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Streptococcaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1369 mntR -31 5.1 ATAATTAAATGGAGAAAAGTAA
Lactococcus lactis subsp. lactis Il1403
L84767 mntR -31 5.1 ATAATTAAATCAAGAAAAGTAA
L150744 mntB -87 4.9 CAAAATATATTGATTTAATTTT
Streptococcus agalactiae 2603V/R
SAG0745 mntH -85 5.5 ATTATTAAGTAGCGTTAATTTT
SAG1533 mntA -59 6.3 AAAATTAAGTTAACTTAATTTA
SAG1534 mntR -151 5.1 AAAATTAATATAAGTTATGTAT
SAG1534 mntR -129 6.2 TAAATTAAGTTAACTTAATTTT
SAG1518 nikA -56 5.2 CTAATTAAGTTTGCTTAAAAAA
SAG1518 nikA -34 5.2 ATAATTAACTAAACTTAAAAGA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0487 mntR -116 6 TTAATTAAGTATAGTTAAATAT
SDEG_1473 SPy1434 -54 5 ATAATTAATATATCTTAAAGAT
SDEG_0488 mntA -51 6.1 ATATTTAACTATACTTAATTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1469 mntA -51 6.4 ATAATTAACTATACTTAATTAA
Sez_1456 nikA -79 5.9 TAAATTAACCATACTTAATTTT
Sez_1470 mntR -116 6.2 TTAATTAAGTATAGTTAATTAT
Streptococcus gallolyticus UCN34
GALLO_2047 mntA -53 5.8 AAAATTAAGCATGCTTAATTTT
GALLO_0590 mntH -78 5.2 TTAATTAAATACGCTTTATTTT
Streptococcus gordonii str. Challis substr. CH1
SGO_1800 mntB -60 6.4 AAAATTAACTTGACTTAATTTT
Streptococcus mitis B6
smi_0705 prtA -194 5.6 AAAATTAACCAGCCTTAATTTT
smi_1232 mntH -164 5.2 AAAATTAACCAATATTAATAAT
smi_0636 mntB -62 6.1 AAAATTAACTTGACTTAACTTT
Streptococcus mutans UA159
SMU.182 mntB -57 6.4 AAAATTAACTTGACTTAATTTT
Streptococcus pneumoniae TIGR4
SP_1648 mntB -62 6.4 AAAATTAACTTGACTTAATTTT
SP_0641 prtA -194 5.8 TAAATTAACTAATGTTAATTTT
Streptococcus pyogenes M1 GAS
SPy1434 SPy1434 -86 5.1 CTAAATTACTTGACTTATTTAT
SPy1434 SPy1434 -53 5 ATAATTAATATATCTTAAAGAT
SPy0450 mntR -116 6.3 TTAATTAAGTTTAGTTAATTAT
SPy0453 mntA -51 6.4 ATAATTAACTAAACTTAATTAA
Streptococcus sanguinis SK36
SSA_0262 mntB -29 6.4 AAAATTAACTTGACTTAATTTT
Streptococcus suis 05ZYH33
SSU05_0309 SPy1434 -135 5.4 ATAAATAACTTGACTTTCTTTT
SSU05_1982 prtA -32 5.1 TAAATTAATTAAACTTAAAAAA
SSU05_0309 SPy1434 -103 5.3 ATAATTAACTTAGTTAAATGAT
Streptococcus uberis 0140J
SUB0473 mntA -32 4.9 TTAATTATATAATATAAATTAA
SUB0473 mntA -50 6.1 ATAATTAACCATACTTAATTAA
SUBp03 mntR -117 5.9 TTAATTAAGTATGGTTAATTAT
SUB1266 SPy1434 -54 5.3 ATAATTAAGATGAATTAAATTG
SUB0826 prtA -83 5.7 ATTATTAAGTATACTTAATAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD