Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator XapR in Enterobacteriales

Properties
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Regulog: XapR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_00389 xapA -120 6.2 TCAATATACATTTTATATCGA
Edwardsiella tarda EIB202
ETAE_2779 xapA -115 4.4 TCCCTAGCAAATCAATACTGA
Enterobacter sp. 638
Ent638_2934 xapA -121 5.2 TTGATACTGAAAGAGTATTGA
Escherichia coli str. K-12 substr. MG1655
b2407 xapA -107 5.9 TCGATATCGAATCGCTATTGA
b2407 xapA -132 4.2 TTAATAGAGAAAAGATATAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD