Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Rhizobiales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc02047 gcvT -144 45.7 CCGGTAGGACTCTGGAGAGAAGCGTTCGCGCTCGCCGAAGGGATAACAATCTCAGGCAAAGGGACAGAGGGGGCTCG
SMc02047 gcvT -231 54.2 TTCGACCTCGTTGGGAGAAACCGGTTCGATCCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAGGACCAGCAAGG
Rhizobium sp. NGR234
NGR_c15490 gcvT 142 46.9 CCGGTAGGACTCTGGAGAGAAGCGGTTACGCTCGCCGAAGGGATAACAATCTCAGGCAAACGGACAGAGGGGGCTCG
NGR_c15490 gcvT 55 59.8 GACGATCTTGTTGGGAGAAACCGGTTCAATCCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAGGACCAGCAAGG
Rhizobium leguminosarum bv. viciae 3841
RL2572 gcvT -248 56.6 CAACCTTGTTGGGAGAAGCCGGTGCTTTCGCCACCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCAGCAAGGGG
RL2572 gcvT -156 52 GACGGAACTCTGGAGAGAAGCGTTCTTGAAACGCTCGCCGAAGGGATAACAATCTCAGGCAAAGGGACAGAGGGGGCTCAGG
Rhizobium etli CFN 42
RHE_CH02241 gcvT -249 53.7 CAACCCTGTTGGGAGAATCCGGTGCTTTCGCCACCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAGGACCAGCAAGGGG
RHE_CH02241 gcvT -157 47.4 GACGGAACTCTGGAGAGAAGCGTTCTCGAAACGCTCGCCGAAGGGATAACAATCTCAGGCGTCAAGGACAGAGGGGGCTCAGA
Agrobacterium tumefaciens str. C58 (Cereon)
Atu1464 gcvT -155 41.3 ACGACGGAACTCTGGAGAGAAGCCACCTTGACTAAAGGACGGCTCGCCGAAGGGATAACAATCTCAGGCGACAAGGACAGAGGGGGCTCT
Atu1464 gcvT -240 58.8 CGCATCATCGTTGGGAGAAACCGCTTCATTGCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCAGCGATG
Mesorhizobium sp. BNC1
Meso_1018 gcvT -149 48.7 GGTTAGACACTCTGGAAAGTCGGGGCTTTTGCCCCGCGCCGAAGGTGTAAGCGTGGCCGACAGGGTTCCGGCGCGCGAGTCTCTCAGGCTTCAGACAGAGGGGCACGG
Meso_1018 gcvT -232 53 CTGCCCGTCCGTGGGAGAGAGCAGCCCGGCTGCCGCCGAAGGGGAAATCGCCCGAAATCTCTCAGGCAAAAGAACCGCGAATG
Meso_4248 null -242 54.8 AACTGGTTGCGGGAGAGAGCAGCGCACGGCTGCCGCCGAAGGGGAATACGCCTAAAATCTCTCAGGCAAAAGAACCGTAAGCAGG
Meso_4248 null -158 45.5 GGCGACACTCTGGAAAGACGGGGCCTGTCAAAGATCCCGCGCCGAAGGTGTAAGTGCTATCGGAGCCCTATCCGGCAGCGCGAGTCTCTCAGGCTTCAGACAGAGGGGCACGGAA
Mesorhizobium loti MAFF303099
mlr0883 gcvT -235 61.3 ACCTGTTTGCGGGAGAGAGCAGCGAGAGCTGCCGCCGAAGGGGAAATCGCCCGAAATCTCTCAGGCAAAAGAACCGTAGACGGG
mlr0883 gcvT -151 48.9 AAAGACACTCTGGAAAGTCGGGGCTTGCCCCCGCGCCGAAGGTGTAAGCGCCGCTGACAGAGTTCCGGTTGCGCGAGTCTCTCAGGCTTCAGACAGAGGGGCACGGAC
mlr9201 dadA -217 45.8 GGGAGAGATCGGCTACTGCCGACGCCGACGGAGCAACCCCCCAAGGAAACTCTCAGGCAAAAGTGACCGCA
mlr9201 dadA -143 49.7 CCGAACGATCTGGAGAGAGACGCCTCGAGCGTCCACCGAAGGGGAAAGCCGGCAGGCCCGGTTAAGCTCTCAGGTAGCCGAGACAGATTTGGGGATTT
Brucella melitensis 16M
BMEII0559 gcvT -231 48.6 GTCTGTTTGCGGGAGAGAGCCGTTAAGGCCGCCGAAGGGGAAAACGCCCGAAATCTCTCAGGTACAAGGAACCGCAGGCGGG
BMEII0559 gcvT -148 49.7 AAGACAACTCTGGAAAGTCGGGGGCAACTCCGCGCCGAAGGTGTAAGTATGGCTTTATATATAGCCATGCGAGTCTCTCAGGCCTGAGACAGAGGGGCACGAAC
Bartonella quintana str. Toulouse
BQ10130 gcvT -137 26.7 AAGGCAGATCTGGAAAATCGGGAGGATCCACGCCGAAGGTGTAAGCGAAAGCTCTTTTCGCGAGTCTCTCAGGTTTGTGACAGAGGAATGCAG
BQ10130 gcvT -243 15.8 ATCGGAATATATTGGAAAGAACATTGTTGTTTCTTTTTTTCGTATCTGCAGCCGAAGGGGAAAACAGCCCATAGTCTCCTCATGCTCTAAGGACCGTAAAAGAAGG
Rhodopseudomonas palustris CGA009
RPA3848 gcvT -223 49.8 TAAGTCGCGTCGGGAGAGATCGGCCGCAAGGCCGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAACGGACCGCGCGGCCG
RPA3848 gcvT -136 35.1 GACTGACATCTGGAAAGAGACCCTGCCGGGCGATCCCGGGACGGGTCCGCCGACGGGATAATGCTCTCAGGCACAGCGACAGATGGGGCTCGAA
Bradyrhizobium japonicum USDA 110
blr5751 gcvT -233 55.5 ACGGCCACGTCGGGAGAGACCGGCTTTAGGCAGCCGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGCGTGGCTTT
blr5751 gcvT -143 38.3 TGACAGCATCTGGAAAGAGGCGCCGACGAGCTTGAGGCTCGGACAGCGTCCGCCGACGGGATAATACTCTCAGGCACAGCGACAGATGGGGCTTCGA
Bradyrhizobium sp. BTAi1
BBta_5449 gcvT -257 48.2 CAGTCGCGTCGGGAGAGACCGCTCTCTTGAGGTTCTGCTTGAACTTCAAGGATCGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCCTCGCGACT
BBta_5449 gcvT -147 35.6 CTACTGCATCTGGAAAGAGACGCTGGCCGGGCCTGATCCCGGGAAGCGTCCGCCGACGGGATAATACTCTCAGGCACAGCGACAGATGGGGCTTCGG
Nitrobacter winogradskyi Nb-255
Nwi_1286 gcvT -144 38.8 ACTGGTTACATCTGGAAAGAGACCCTTGCGGACCGGCGGTCCGTACAGGGTCCGCCGACGGGATAATACTCTCAGGCACAGCGACAGATGGGGTCTC
Nwi_1286 gcvT -246 48.3 GTTTAGTCGCGCCGGGAGAGATCGGCCGCTTTCCGGATGAGGAAGCAGGCTGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAACGGACCGCGCGA
Azorhizobium caulinodans ORS 571
AZC_4245 gcvT -318 50.7 TGATCCCTGCGGGAGAGACCGGAAGCTGTCGAAAGGCAGGATCCGGCGCCGAAGGCGCAACCGCCCCGGAACCGCTCAGGCACAAAGGGCCGCAGGGTGACGAG
AZC_4245 gcvT -213 32 CTCTGGAAAGCAGTCGCGGATGCGATGCTGGTCCGGAGCGTTTGGCGTTTTGCGCCTCGCTTCCGGCTGCATGGATCAAGCGACTCACCGAAGGAGTAAGCCGGCCCTTCCGCGTGACGGGGTTCCGGTGAATCTCTCAGGTTCCTGCGACAGAGGGG
AZC_2080 dppA -18 50.4 CCAGAAGACGTCCGGAGAGTGACCGGCCCTGCCGGTCCGCCGAAGGAGCAAGCCGCGTCAGCGGTGAATCTCTCAGGCCCAGAACGGACGGGGCGAC
AZC_2080 dppA -104 60.4 AATGGCAGCACCGGGAGAGACCGGATCGATCCGGCACCGAAGGAGCAACCGCCCCGGAAACTCTCAGGTCAAAGGACCGGTGCCT
Xanthobacter autotrophicus Py2
Xaut_2201 gcvT -314 48.2 GACGATCCCTGCGGGAGAGACCGGCGGCCGCAAGGTACGCCGGCGCCGAAGGCGCAACCGCCCCGGAACCGCTCAGGCCCAAGGACCGCAGGGGGACG
Xaut_2201 gcvT -216 38.3 AATCTCTGGAAAGCAGCGCCGGTGCTGCGCGGCAACGCGCATCTTCGGCGCTCACCGAAGGAGTAAGCCGTGCCCTTCCACGAGGCGCGGTGAAATCTCTCAGGTCCTAAGACAGAGGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD