Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Rhizobiales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc01609 ribH2 -200 106.7 AGCGTTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTAGCGAACACAGGATCGGGAATGGTCGGTGGTCGGAGCCCGCGAGCGCTTCGCATTTCGTGCGAAGGTCAGCAGATCCGGTCGAATTCCGGAGCCGACGGTTATAGTCCGGATGGAAGAGAGCAAGCAG
Rhizobium sp. NGR234
NGR_c21540 ribH2 -252 97.8 CGCGTTCTCAGGGCGGGGCGGAATTCCCCACCGGCGGTAGCGATCGGCGGATCTAACGGTCCGGTGGTCGAAGCCCGCGAGCGCTTCGAGGCCTACCTCGAAGGTCAGCAGATCCGGTCAGATTCCGGAGCCGACGGTTACAGTCCGGATGGAAGAGAGCAAGCAG
Rhizobium leguminosarum bv. viciae 3841
RL3153 ribH2 -219 116.8 GCCGTTCTCAGGGCGGGGTGCAAGTCCCTACCGGCGGTATGCAATTTCGATTGCGAGCCCGCGAGCGCCTTCTTCGGAAGGGTCAGCAGATCAGGTGAGATGCCTGAGCCGACGGTCATAGTCCGGATGAAAGAGAACGTGCGT
RL2726 ribB -276 120.1 AATGTTCTCGGGGCGGGGTGTAATTCCCCACCGGCGGTATCAGGAGCAATCCTGGAGCCCGCGAGCGCTTCCGGCACCTCCTGTCGGAAGGTCAGCAGATCCGGTGAGATGCCGGAGCCGACGGTATAGTCCGGATGGAAGAGGACAACACG
RL1692 ribN -238 114.4 TCTGTTCTCAGGGCGGGGTGAAACTCCCCACCGGCGGTAAGGGTTTCGGCTCGAGCCCGCGAGCGCCTTTCCTCGTGTCCAAGCGGGGGAGGGGTCAGCAGATCCGGTGCGATTCCGGAGCCGACGGTTAAAGTCCGGATGGAAGAGAATGAGCAT
Rhizobium etli CFN 42
RHE_CH02688 ribH2 -221 117.1 GCCGTTCTCAGGGCGGGGTGAAAGTCCCTACCGGCGGTATGCAGTTTCGATTGCGAGCCCGCGAGCGCCTTCCTCGGAAGGGTCAGCAGATCAGGTGAGATGCCTGAGCCGACGGTCATAGTCCGGATGAAAGAGAACGTGCGC
RHE_CH01591 ribN -299 112.4 GCTGTTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAAGGGCTGCGGCCCGAGCCCGCGAGCGCCTTCTCAAGCTTCGCCCGGAGAGGGGTCAGCAGATCCGGTGCGATTCCGGAGCCGACGGTATAGTCCGGATGAAAGAGAATGAGCAT
Agrobacterium tumefaciens str. C58 (Cereon)
Atu1895 ribB -270 112.6 GTTGTTCTCAGGGCGGGGTGCAATTCCCCACCGGCGGTATCGGGATTTGTCCCGGAGCCCGCGAGCGCTTCCGGTCTCCAAAGCCGGAAGGTCAGCAGATCCGGTGAGAGGCCGGAGCCGACGGTATAGTCCGGATGGAAGAGGACAAGGCA
Mesorhizobium loti MAFF303099
mll7281 ribH2 -227 121.3 TTAAAGTTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAAGGGCCTCAAACCCAAGCCCGCGAGCGCTTTCCAAGACAATTGGAAAGGTCAGCAGATCCGGTGTGATTCCGGAGCCGACGGTTAGAGTCCGGATGAAAGAGGACGAAA
Brucella melitensis 16M
BMEII0589 ribH2 -241 120 GGCTTGTTCTCGGGGCGGGGTGAAACTCCCCACCGGCGGTATGAAAAGCAATTTTCAAGCCCGCGAGCGCCTGAAATGGAAGCCGATTCGCATGCCATTTCAGGGTCAGCAGATCCGGTGAGATGCCGGAGCCGACGGTTAAAGTCCGGATGGAAGAGAGCGAAT
Bradyrhizobium japonicum USDA 110
bll7452 ribH2 -252 108.6 GATAAGTTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAAGGGCCGAAAGGCCTAAGCCCGCGAGCGCCTTCTCCTTGATAGGGATTCCCTCGGGGACCCCTCGGAGGGAAGGGTCAGCAGATTCGGTGCAACTCCGAAGCCGACGGTTAAAGTCCGGATGAAAGAGAACGGTC
Bradyrhizobium sp. BTAi1
BBta_1745 ribH2 -271 97.6 CATGTTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTAAGCGCTCTCGGTCGAGCGCGCGAGCCCGCGAGCGCCTTCTGCAAAAGGCGTAATCCGGGGAATCCTGTTCCCCGGATCGCGCCAAGAACAGAAGGGTCAGCAGATTCGGTGCGATTCCGAAGCCGACGGTCACAGTCCGGATGAAAGAGAACGGGTCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD