Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FasR in Corynebacteriaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid biosynthesis
Effector:
Regulog: FasR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium amycolatum SK46
CORAM0001_1183 fasB -102 5.8 ACATGATGGATTCCTCATGA
CORAM0001_2207 accD1 -2 5.7 ACATGACTATTTCCTCACGT
Corynebacterium aurimucosum ATCC 700975
cauri_0555 accBC -78 5.7 ATGTGAAGGTATCCTCATGT
cauri_0563 accD1 -2 5.7 ACATGACTATTTCCTCACAT
Corynebacterium diphtheriae NCTC 13129
DIP1846 fasB -101 5.9 AGATGACAGTTTCCTCATAT
DIP0660 accD1 -2 5.5 ACATGACCATTTCCTCATCT
Corynebacterium efficiens YS-314
CE2392 fasB -165 5.9 AGATGACGTTTTCCTCATGA
CE0738 accD1 -2 5.3 ACATGACCATTTCCTCACCT
Corynebacterium glutamicum ATCC 13032
cg2743 fasB -168 5.9 AGATGACGTTTTCCTCATGA
cg0957 fasA -105 5.7 ACATGAGGGTTTAGTCATCT
cg0802 accBC -121 5.4 ATATGAGTAAGTCCTCATAT
cg0812 accD1 -2 5.3 ACATGACCATTTCCTCACCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD