Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Chlorobiales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Chlorobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroherpeton thalassium ATCC 35110
Ctha_0748 ribB -249 110 AACTTGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTGTTCCAAACTTTTGGAGAGCCCGCGAGCGCTCCCAGGTGGGAGGTCAGCAGATTTGGTGAAAAGCCAAAGCCGACGGTGAAAGGCCGGATGGAAGAGGATAAGG
Chlorobium limicola DSM 245
Clim_0178 ribB -206 101.8 TTGTTTCTCAGGGCGGGGTGCAAGTCCCCACCGGCGGTATTCCGGGTACGTATCCGGAGAGCCCGCGAGCGCTTTCGCTGCAAGGCGGAAGGTCAGCAGATTTGGTGCAAAGCCAAAGCCGACGGTCATAGTCCGGACGAAAGAGAATGAGAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD