Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Rhizobiales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SM_b20556 cbtC -261 125.5 ATACCAGATCATGTGATGGTTCCGCCCGACTGAAGAACGGCGGATGAAAAGGGAACACGGTGAGGACGACCCATCAGGGGCTAAAACCGTGGCTGCCCCCGCAACTGTGAGCGGCGAGCAAAGTCCAAGGATGCCATTGGCCATGAATCGGCTGATAAGGCGGACAAAGCTACGACCCGCAAGCCAGGAGACCTGCCATCACCTTGGGCGACACGCC
SMb20056 btuF -397 118.6 CATTAACTGGGACCGACGGTTCCCCTACCCGTGAGGTGGAGGGGATTAATAGGGAACACGGTGCGGACGACCCAAGAGGGACCAAAACCGTGGCTGCCCCCGCAACTGTAAGCGGATCGTCGTTCATCCTTGTGGCGCCAAGGCGCCAGCCACTGCGCGCGTTGCGCGGGAAGGCAGATGAGCGACTCTGTCCGTGAGCCAGGAGACCTGCCGTCAAATCGATCCAACGTCA
SMc00982 ardX -316 103.1 TAGATGAGGACACTCAAGGTGCCGCCTCGAAGGGAGGGCGGAGAATTGGGAAGCCGGTCAAATCCCGGCGCTGCCCCCGCAACGGTGGTGGAGCGAACAGCCACGGCAGAAGGCCACTGGACACCGCGTCCGGGAAGGCGCCGGGCAGGTCCCTTGCGGACGGCTCCAGAGCCCGGAAACCAGCCTTGAAGCAGAAATAGACCGT
SMc00166 bluB -259 92 TGGCCATATGCCGCCGTCAGGTGCCCGCGAAATGCGGGGGAATCGGGAAGCCGGTGCAGTTCCGGCACGTGCCCAACGCTGTGAAGGGGACGTTCTCGCCAAAAAGGGCTCTGAATCTTTTCAGAGCTTTGCCACTGAATATTGAAGCTATTCGGGAAGGCGGCGCGAACGGATGATCCGAAGTCAGAAGACCGGCCTGGCGAGATAGACCGGCC
Rhizobium sp. NGR234
NGR_b02510 btuF -422 117 CTAAGCAAGCCGACGACGGTTCCCCTACGACGAAGCGAAGGGGATTAATAGGGAACACGGTGCGGACGACCCAACAGGGACCAAGACCGTGGCTGCCCCCGCAACTGTGAGCGGATTGCCGCCCATCCTCGTGACGCGCAAGCGTCGTGCCACTGCGAATTCGATCGCGGGAAGGCAGGTGGACGGCAGATATCCGCAAGCCAGGAGACCTGCCGTCATGCGTTCACTCCAATC
NGR_c26320 ardX -327 109.2 CTCATATGAACACGCTTGAGGTGCTGACCGGTTTTCGGACCGGTCGGAGAATTGGGAAGCCGGTTTGATGCCGGCGCTGCCCCCGCAACGGTAGCAGAACTCAAATGCGACGGAAGTCCACTGGGCAAGATGCCTGGGAAGGAGTCGCAGGTCCGAAAGGACGGTTCTGGAGCCCGGAAACCAGCCTCGACGTTTTGAACTCGA
NGR_c21910 cbtB -314 56 ATCATCGCTGATCGGTTGGTTCCCGGAATGCGAACGCGTTTCGGGAGTAAACGGGAACGTGACGGATGGACCCAAGCTGGGCATCTCAATCACGGCCGACCCCGCGACTGTAGAGCGGCGTGAATTTGTCGTTCCGGAGCAATCCGGGAGAAGCCACTGGGTATAAACCGCGAGAGGGCGGTTCGAATCTGGGAAGGCGAGGCAAGTTCCTTGGTGTCTAATCTAGACATCTGACGCCGTGAGCCAGGAAACCTGCCAAGCGATACGGGCATAGTGC
NGR_c16920 bluB -257 78.6 TGCCCATATGCGGCCGTCAGGTGCCCGCTTGCTGCGGGAGAATCGGGAAGCCGGTTGAATTCCGGCACGTGCCCAACGCTGTGATGGGGACGGCTGCGCCAAGAGAGCTGTGAAGGTTTTCAGAGCTTTGCCACTGGGTCTTGAAGCGATCTGGGAAGGTGGTTCGGCCGAGTGATCCAAAGTCAGAAGACCGGCCTGGCAAGATAGACCGGCC
Rhizobium leguminosarum bv. viciae 3841
RL4261 nrdH -507 111.2 TACCATATCTAGTGTTCGAGGTTCCGTCGATTCGTGAGGATCGGCGGCTAAGACGGAAATTCGGTGCGCGTCGCCATCATGGCGCGGCAATGCCGGAGCTGCCCCCGCAACTGTGAGCGGCGAGCAACTGTCCGATTTCAGGTCACTGGAGCATGATGCTCCGGGAAGGCTGGGGCAAAGTGCTTTGACCCGTGAGCCAGGAGACCTGCCTCGAATGAAACGTCCACG
RL3052 btuF -435 102.6 CGACGTAACTGGGCGCGACGGTTCCCTGAAGATGACTCCAAGGGGATTAATAGGGAACACGGTGAGGACGACCCAGTAGGGACCGAGACCGTGGCTGCCCCCGCAACTGTAAGCGGATTGTCGATCATCTCAGAAGTGGCCAGCGACCGGCCATCTCTGAAGGGCTCATAGCCCTACCACTGCGAGATATCGCGGGAAGGAGGATGAAACGACGGATATCCGCAAGCCAGGAGACCTGCCGTCAATCACGATCCAATC
RL2681 bluB -279 101.4 TGAAATAGATGCGCCGTCAGGTGCCCGCCGGTAAGGCGGGAGAATCGGGAATCCGGTGCAAGACCGGAACGTGCCCAACGCTGTAAGGCCGACGTTTGCCGCTTCATCACGCCACTGGCTTTTCGCCGGGAAGGCTGCGGCAGACGGATGACGCCCAGTCAGAAGACCGGCCTGGCAAGATAGACCGATC
Rhizobium etli CFN 42
RHE_CH02368 bluB -229 100.9 TGAAATAGATACCTCGTCAGGTGCCCGCTTTCACGCGGGAGAATCGGGAATCCGGTGCAAGACCGGAACGTGCCCAACGCTGTAAGGCCGACGCCCGCCGCTTCATCATGCCACTGGGTTTTGCCGGGAAGGCTGCGGCAGACGGATGACGCCAAGTCAGAAGACCGGCCTGGCAAGATAGACCCAAC
RHE_CH03718 nrdH -485 116.9 TACTATATCTAGTGTTCAAGGTTCCTTCGATTCGTCAGGATCGCGGGCGAAGATGGGAATACGGTGCGTTTCGCCATGACGGCGCAACAAGGCCGGAGCTGCCCCCGCAACTGTAAGCGGCGAGCAACTGTCCGATTTCAGGTCACTGAGGCATGATGCCTCGGGAAGGCTGGGGCAGGGTGCTTCGACCCGCGAGCCAGGAGACCTGCCTTGAACTAGATGTCCACG
Agrobacterium tumefaciens str. C58 (Cereon)
Atu0068 nrdH -531 126.6 CTATATGTGGTGTTCAAGGTTCTTCCGATTCGCTAGGGTTGGGAGCTAAGACGGGAATTCGGTGCGTAACGCCATCACGGCGGAGCAAGGCCGAAACTGCCCCCGCAACTGTGAGCGGCGAGCATCGTTCCGATTTGAGCCACTGGAGCCAAAAGCTCCGGGAAGGCTGGAATAGATGTTGTGACCCGCAAGTCAGGAGACCTGCCTTGAGCGCAAATGTCCACGG
Atu1654 bluB -310 105.7 CCCATAGCTTCTCCGGTCAGGTGCCCGCCCTTGCGGCGGGAGAATCGGGAATCCGGTGAAAGACCGGAACGTGCCCAACGCTGTAAGGCGGATGCTCTTTTTCTCATGCCACTGAAGCAATTCGGGAAGGCGAAAGGGGCGGATGAAGCTTAGTCAGAAGACCGGCCTGGCAGGATAGACCGAAC
Atu0883 cbtB -388 122.3 GATAACATGTCCGTGATGGTTCCTTCCGGGCGTTCCGGAAGGTGAAAAGGGAACACGATAGGGACAAATCCTCATTCGTGGCTGCCCCCGCAACTGTGAGCGGAGAGCCTGAAACGAAATGCCACTGGCAAGCCATCTCGCCTCCATCAAGGGGGAAGGCAATGCCGGGAAGGTGTTTCAGGTTTTGACCCGTAAGCCAGGAGACCTGCCATCACGGAAATATCCATGCC
Atu3826 achX -305 132.7 CATTGGTTAGCCATCGTGGTTCTGCGGACGAAGGTCCGGAGCTAAGAGGGAATTCGGTGAGGGCTTTAATCACAGCCTGAATCCGAAGCTGCCCCCGCAACTGTAAGCGACGAGCGAAAGTCCATCATGTCACTGAGGCCGGCCTCGGGAAGACGGACCAAAGCTATGACCCGCAAGCCAGGAGACCTGCCGCGATAGATAACGTCCACGG
Atu3396 btuF -394 114.4 CCTTATGTGAGAAAGCGACGGTTCCTACAGCCGAAAGGCGAAGGGATTAATAGGGAACATGGTGCGGGCGATCTTTTTCGTCCAATGCCTTGGCTGCCCCCGCAACTGTAAGCGGATTGTTGTTCATCCCAGTGACGCTTGAAGGCGTCATGCCACTGTTTTTTTCGGAATGCGGGAAGGCAGATGAGGGACGCAAATCCGTGAGCCAGGAGACCTGCCGTCAAAATGGAAACCATC
Atu2806 cfrX -304 129.9 CTAAGGGTAAGGGACTGACGGTCTTTTCCCGGCAACGGGAAAAGCTAAGAGGGAACACGGTTCCGCCCCGAGAAAGGGTCATTCCGTGGCTGCCCCCGCAACTGTAAGCGGTAAGCCCGCACCGTAAAGCCACTGAACCTTTATGATCGGTTCGGGAAGGCGGTGACAGGGTGTTGATAGCCGCAAGCCAGGAGACCTGCCGTTTCAGGAAAAAGCGTC
Mesorhizobium sp. BNC1
Meso_2703 nrdA -308 134.1 ACTAAATATAGCCCATCACGGTGCTGTCGAGTCGTTCGGGTCGAGAGCTTAAGAGGGAAGCCGGTGTGAGGCCGGCGCTGCCCCCGCAACTGTAAGCAGCGAGCTTGTGTCGCGTATTGCCACTGGTGCTCCTAGAGCGCTGGGAAGGCCTGACAGAAGCGATGACCTGCAAGCCAGGAGACCTGCCGTGATGAGCATTGAACGT
Meso_2701 null -348 132.9 GCAAATCTGCACACGTCGTGGTCCCCGGCGTCTTTCAGCGCCGGGGCTAAGAGGGAATTCGGTGCGCCCGTCAGCGCTATTGCGCTTTCCGAAAGCTGGTTTTGGTTTTCGGGGTTGATGTATCGGGTAATGCCGAAGCTGCCCCCGCAACTGTGAGCGGCGAGCTCTTCTCCAACATGCCACTGGAGACACCCGGGAAGGCGGAGAGAGGCTGTGACCCGCGAGCCAGGAGACCTGCCATGACGAGAACGTCCACG
Meso_2063 btuB1 -318 116 GTCTCGGCCGTGCCTGAGGTGCCCCGTCCGCAAACGGGGTTAAAAGGGAATATGGAAGGGCATTTTCCGCCCGAGCCATAGCTGCTCCCGCAACTGTCAGCGCTGAGGCTTCCTCAACATGCCACTGGGCCCTTTCGGCCTGGGAAGGCGAGGACGCCGTCGAAGCGCAAGCCAGGAAACCTGCCTTGGGTCGTCACCGTCCGGA
Mesorhizobium loti MAFF303099
mll6123 null -317 130.9 GTGATTGTGCGCATGTCGTGGTTCTCCGCGCGGCACTGCCGTAGCGGAGCTAAGAGGGAAGCCGGTGCGATGCCGGCGCTGCCCCCGCAACTGTTAGCGGCGAGCCAAGCCCATTGGTGTCACTGAGGCGAACGGCCTCGGGAAGACGGGCAGAGGCTTTGACCCGCGAGCCAGGAGACCTGCCACGACGAACAACGTCCAC
mlr8225 cfrX -212 131.3 TACGGTGGGTGCGTGATGGTCCCCGCGCCGAAAGGCAAGGGGTGAAAAGGGAACACGGTGAGACCTCAAAAGGTCGAGACCGTGGCTGCCCCCGCAACTGTAAGCGGAGAGCAAGATCCGACATGCCACTGGCCGGCAAGGCTGGGAAGGCAGGATTGCGCTGAGACCCGCGAGCCAGGAGACCTGCCATCACTGAGTTGACCGGACG
mll5101 ardX -316 105.8 ATTAGATCATGTCATCTCAGGTGCCGCTTCGTGACGACGGGGCGGAGAATTGGGAAGCCGGTCAAAGTCCGGCGCTGCCCCCGCAACGGTGGTGGAGTTCAAGTCGCAACGGGAGACCACTGGGCAAAAGCCTGGGAAGGTGTCGCGACCGTCCGCAAGGACACTCCAGAGCCCGGAAACCAGCCCGAGATTTTTGAACTCGA
msl1310 cbtB -217 120.7 CTATAGTCATGCAGTCGTCGGTTCCGTTTTGGAGCCAAGAGGGAATGCGGTGCGGGCGAAATTCTTGCCCAATGCCGTGGCTGCCCCCGCAACTGTGTGCGGTAGTCCTCTCCATATGCCACTGAAGATTCGTCTTCGGGAAGGTGGGGAAGGGCGCTGATCCGTGAGCCAGGAGACCTGCCGACGACGGCAAAACTGAC
mll7468 bluB -241 92.1 AAGGTCGCCGCCACTGCCTGGTGCCCGCCGCAAGCGGGAGAATCGGGAACACGGTTGAACTCCGTGGCGTGCCCAACGCTGTAAGGGGGACCGCGCCGGTAAATGCCACTGTCGATGACGGGAAGGCACCGGACGCGGGTTGATCCCGAGCCAGAAGACCGGCCTGGCAGGCATCGTCATCC
mlr1374 cfrX -414 122.4 CTAAATCCGCTCCAGACGGTCCCTTGCCCGCAACGGCAGGGGCTAAGAGGGAATGCGGTGCGGGATTTCGATCTCAAATCCGCGGCTGTCCCCGCAACTGTAAGCGAAGAGCCAAGGCCGAAAGCCACTGGGACGTTCCCGGGAAGGCGGCACCCAAGGCGATGACCCGCGAGCCAGGAGACCTGCCGTCTGCGACAAAAGAATCCG
Brucella melitensis 16M
BMEI0657 btuB1 -447 108.6 CGCAATTTTCAGGAGACGGTTCCGCCATTGCGGCGGATGAAAAGGGAACACGGTGAAGCCATAGGGCTGAAACCGAGACTGCCCCCGCAACTGTAACCGGAGAGCTATCCTCCACAGGCCGCGCAAGCGGCCAAAGCCACTGAAAGCAGCAATATGCTGCAATCGGGAAGGCGGAGGCAAAGCGAAGACCCGGAAGTCAGGAGACCTGCCGTATCCGGTCACCCATGCTT
BMEI0691 cbtB -299 80.3 TGTCAAACCATGTGACAGGTTTTGCCGGAACGAATCCCCGGCAATACCAAAAGGGAATGCGACGGACGGACCCACGCCGGGCGTCTTTATCGCAGCCGACCCCGCGACTGTAGAGCGGAGAGGGAAGAGGCAAGCCGGGCAACCGGCAGCCACTGGAAATCAGATGGATTTCTGGGAAGGCGCTTTATTCCCCAAGACCCGCGAGCCAGGAGACCTGCCTGTTGCATGAGGGCATTGCG
BMEII0932 nrdH -554 120.9 TACCATATCTTGTGTTCGAGGTTCTTTCGATTCGACGAGTCGGGAGCTAAGACGGGAATCCGGTGCGCTTGCCCATGGTGGGCGGGCAATGCCGGAGCTGCCCCCGCAACTGTAAGCGGCGAGCTTTGCGCCCCATGCCACTGGCGAAAGCCGGGAAGGCGGGTGGAAGCGTTGAGCCGTGAGCCAGGAGACCTGCCTTGAGCGTGAACGTCCAC
BMEII0535 btuF -431 126.1 CGTAATACCGTCATGACGGTTCCCCGACCGAGAGCGAAGGGGATTAATAGGGAACACGGTGAGGACGACCCATCAAGGGGCCGAGACCGTGGCTGCCCCCGCAACTGTAAGCGGATTGCCGTTCATCCTCGTGACGCCGAAAGCGTCATGCCACTGTGCCCACGGCACGGGAAGGCAGATGGACGGCGATTATCCGCAAGCCAGGAGACCTGCCGTCTTACGTAGTCCATTGTC
Rhodopseudomonas palustris CGA009
RPA2397 metE -303 132.1 ATAGTGATCGCCGTCGAGGTTCTTCGGGCACGATCGTCCCGAAGCTAAGAGGGAAGCCGGTGCAAGGCCGGCGCTGCCCCCGCAACTGTTAGCGGTGAGCCGACGTTCAGCAAAGCCACTGGGAGCGATCCCGGGAAGGTCGAACAAAGGCGATGACCCGCGAGCCAGGAGACCTGCCTCGTCGAACGAAACGTCCTC
RPA4803 btuB -310 127.6 CTTCTAATGGCGGTGACGGTTCCCGAGAGGGATGAAAAGGGAATACGGTGCGGACGCAGACACTTTCGCGTTCTAGGCCGTAGCTGTTCCCGCAACTGTAAGCGGATCGTCTTTCGTCGGATGCCACTGGGAACCTCGGTCCTGGGAAGGCGACGGAAGATCAACCGCGAGCCAGGAGACCTGCCGTCATTCGTGGTCACACGCG
RPA0713 cfrX -217 124 CTAGCGTGCCAAGCGATGGTCCTTCCGTCAGGAAGGTGAAAAGGGAAGCCGGTGGGAGGCGCGGTGCGTCTCGATCCCGGAGCTGCCCCCGCAACTGTAAGCGACGAGCCATTGCCGAGGCCACTGGGAATTCCTGGGAAGGCGGCGAATGGCGGCGACTCGCGAGCCAGGAGACCTGCCATCGCGTATTGTGCTTTGAA
RPA2091 null -315 119.3 CCAAACATCGCGCGCCGACGGTGTCCTGTCTTCGGACAGGACGAAGAGGGAATATCGGAAGATCGCTGCCTGCAGCGGTCGCGCCGAAGCTGCCCCCGCAACTGTAAACGGTGAGCCGACGCAATACGCCACTGGATCATATCCGGGAAGGCCGCGTCGGCGACGACCCGTGAGCCAGGAGACCTGCCGTCGCCTGCTATGTTGAC
RPA0407 btuB2 -306 136.6 CAATACCGTGACCAGCGACGGTTCCCGAAAGGGATCAATAGGGAACGCGGTGCGGGCTTTAGGGCTCTATTCCGCGGCTGCCCCCGCAACTGTAAGCGGCGAGCCATTCGCCACACGCCACTGGGCTTTCGTCCTGGGAAGGCGGTGAACGGCAACGACCCGCGAGCCAGGAGACCTGCCGTCAGTCGTGGTCACACG
RPA0994 crdX -389 121.1 CTGGTTTTGACGTCTTCGGTGCCTCGCGTGCGAGGTGAAACTGGGAATACGGTGCGGTGTTTTTCACCTAATCCGTAGCTGCCCCCGCAACTGTAGGCGGATCTGTCCGGATCATGTAGCCACTGACGTCCTCGGCGTCGGGAAGGCGGTCCAGGCGATATCCGTGAGCCAGGAGACCGGCCGAAGACGGGAAGCATCTAAC
RPA2094 cobT -418 111.5 GTGGTGCCGCTCGCTTCGGTGCCCTTCGTTCGAAGGGTGAAACGGGAATGCGGTGCGGCGAGCAATCGCCAAGTCCGCGGCTGCCCCCGCAACTGTAAGCGGATCGTCTCCGGTCACTCCGCCACTGAGTTCGGCATCCTAGAGCCGCTCGGGAAGGCGACCGGGACAATGTCCGCGAGCCAGGAGACCGGCCGAAGTCCGCAACCAAGCC
RPA0724 hoxN -289 119.5 ATTTGATCGCGCCCGTTCAGGTGTGCCGGGAATCGTCCGGCACAGGGAAGCCGGTGCGGGCCCAAGCTTATGGCCGCAAACCCAAATCCGGCGCTGCGCCCGCAACTGTGAGCGGTGAGCGATCCTTCAATCGGCCACTGGGCAGCACTTGCCCGGGAAGGCGAAGGATTGCGACGACCCGTGAGCCAGGAGACCGGCCTGAGTACGTCATCTTCCA
RPA2081 btuF1 -233 122.9 TAACCCGAGGTTGTACCGGTGCCTCTCGCCGAGAGAGGTGAAACGGGAATGCGGTGCGGGGCGATGCCCCAATGCCGCAGCTGCCCTCGCAACTGTGGGCGGATCGGAGCGTCCTCGCATGCCACTGACCAGATCGGTCGGGAAGGCGGACGCGCCGGATATCCGCGAGCCAGGAGACCGGCCGGTACAAGGTGTGCAACTCG
Bradyrhizobium japonicum USDA 110
blr3262 cfrX -314 91.8 AATGGTGGCCCGGCGTTGGTTCCTGTCCTATGACAGGCGAAGAGGGAATGCGATAGGGTCCGAATCGGCAAGATTTGGGTCCAAAATGCAGCCGCCCCCGCGACCGTGACCGGAGAGATGCCCGAGGCCACTGATCCCTGACGGGATCGGGAAGGCGGGGATCGAAGGGCAAAACCCTGCTCCGCAAGCCGGGAGACCTGCCAGCGCGGACGATTTTGGACC
blr2068 (EC 2.1.1.14) -302 108.3 ATAATCCAAGTCGTCGAGGTTCTCCGGTTCCCATTGATCCGGAGCTAAGAGGGAAGCCGGTGCAAATGCCGGCTCTGCCCCCGCAACTGTGAGCGGCGAGCCGCTGTCCGACGATGTCGCTGAAGCCTGCACGGCTTCGGGAAGGCCGGACAGCAGCGATGACCAGCAAGCCAGGAGACCGGCCCCGACAATATATTGGTCCAC
blr3278 btuB2 -284 142.5 TCCTAGATGCTCGCGACGGTTTCCCCCGAGAGGGGATGAAAAGGGAATGCGGTGCGGGGATGTTTCCCCAATGCCGCGGCTGCCCCCGCAACTGTAAGCGGATAATCCTTCGTCAGAAGCCACTGGGTCCTCGGTCCCGGGAAGGCGACGAAGTGGTGACGACCCGCGAGCCAGGAGACCTGCCGTCAGCCGTGGTCACACGCG
blr3274 cbtC -256 99.5 GCACACAGGACGGGCATGGTGCTCGAGGTGGCGCAAAGCGCCGGAGCATAATCGGGAATGGGGATGGGCGGACCCAGTTGCGGCGCCCAAAACCCCAGCCGCCCCCGCGACTGTAAGCGGTGAGGGGCTCCGAACCGCCACTGGGCCGCAAGGTCCGGGAAGGCCGGAGAACCCCAGTGAACCGCGAGCCAGGAGACCGGCCGTGCATGTTTTGAGGCCAAG
bll4766 btuB -329 143.6 TCGTAGATTGATCGGTGACGGTTCTCCGCACGGAGATCAAAAGGGAACGTGGTGCGAGATTGTCCCAATGCCGGGATTGTCCCAACGCCACGGCTGCCCCCGCAACTGTAAGCGGTGAATCTTTCGTCATATGCCACTGGGAATCTCGGTCCTGGGAAGGCGACGTAAGGTAACGACCCGCGAGCCAGGAGACCTGCCGTCAGCCGTGGTCACACG
Bradyrhizobium sp. BTAi1
BBta_3141 hupE -310 126.6 GTATCTAACAGGATGACGGTTCTCCGAAAGGAGAGATTTAGGGAACACGGTGCGGGTTCTGAACCCAAGGCCGTGGCTGCCCCCGCAACTGTAATCGGCGAGTGTGAGGCCAAGACACCACTGGGAAACCGGGAAGGTGGTTTCACGCAGCGACCCGAGAGCCAGGAGACCTGCCGTCGACATTGCTGTTGGCCG
BBta_6080 btuB -326 134.7 CCTACTGTGATGGTGACGGTGCCCCCTGACCGGGGCTCAAAAGGGAATGCGGTGCCGGACGTCCTTAACGGATCGTTCGAAGGCCGCAGCTGCCCCCGCAACTGTAAGCGGCGAATCTCACGTCAGATGCCACTGGGAATTCTCGGTCCTGGGAAGGCGGCGTTGAGGTGACGACCCGCGAGCCAGGAGACCTGCCGTCAGCCGTGGTCACACGCG
BBta_6079 btuB -327 42.6 CCTACTGTGATGACGACGGTGCCCCATAACCGGGGCTCAAAAGGGAATGCGGCGCCGGACGCGTCTCGCGAGGGACATGATCGAAGGGCGCAGCTGTCCCCGCTCGTGCAGGCGGCAAATGACGCGTCATAGGCCACTCGGAAATCCTGGTCCCGGAACGACGTCATGGCGGCTATGACACGCGAGCCAGGGCACCCGCCGTCAGCGGTGGTCACACGCG
Nitrobacter winogradskyi Nb-255
Nwi_2888 nrdA -336 118 TACTAAATATAGTGGCCAAGGTCTCTCGAGTCGCAACACCGAGAGCTAAGAGGGAAGCCGGTGCGTCTCGGTCCGTGATCCGGGCAAGGCCGGCGCTGCCCCCGCAACTGTAAGCGGCGAGCCGAAGTCCACTTGAGTGTCACTGGGGCTGCAAGGCTCTGGGAAGACCGGACCGATGCCTGGACCCGCAAGTCAGTAGACCTGCCGTGGCAAAAAAAGAATGT
Nwi_2890 metE -338 131.9 ATAGGATGGGGGGTCGAGGTTCTCCGGGACGATTCACGCCCGGAGCTAAGAGGGAAGCCGGTGTGTCTTCGGATAAAGCCGGCGCTGCCCCCGCAACTGTAAGCGGTGAGCCGTGGTCCATCATGCCACTGGGTGTTGTCCCGGGAAGGCCGGACCAAAGCTGAGACCCGCGAGCCAGGAGACCTGCCCCGGCAACATAGTCGTCCTC
Nwi_2219 btuB -324 132.6 CCAAACAGATCGGCGACGGTTCTCCCTTGGGAGATCAAAAGGGAACGTGGTGCGGGATCATCCTAACACCGGGATCATTCCAACGCCACGGCTGCCCCCGCAACTGTAAGCGGCGAATCTGCGTCACACGCCACTGGGACATCTCGGCCCCGGGAAGGCGACGTCAGGTAACGACCCGCGAGCCAGGAGACCTGCCGTCAACCCGTGGTCACACGC
Azorhizobium caulinodans ORS 571
AZC_0148 cbtC -316 106.9 GCTAAGGTGTCATCGGGAAGGTGCGGCCCTTTGGGGCCGTGAAAAGGGAATCCGGTGCGGCCACAAGGCCCAGGCCGGAGCTGCCCCCGCAACTGTAAGCGGCCGAAGACGCGATCCTCATGCCACGGGCACGCCCCGGAAGGCGATCGCGGACAGGACGCGAGCCAGGAGACCTGCCTTCTCGCAACTGAACTCG
AZC_3933 cfrX -310 94.9 TTAGTGGCCCCATCGATGGTCCCGGTCGGGCGGCGTTCTGCTCTGCCGGGTGAAAAGGGAATGCGAAGCGGGCCGGCGCCTTCAGGCGCCAAGGTCCGTCAACCGCAGCTGCCCCCGCAACTGTAGGCGGTGAGTCGGTGCCACGAGCCACTGGACGCCAGGAGACATCCGGCGCCGGGAAGGCGGCACAGGACCGTGACCCGCAAGCCAGGAGACCTGCCATTGATGAGGAACGCGCCGG
Xanthobacter autotrophicus Py2
Xaut_3774 cbtB -243 121.8 ATAGTCGTCCCGTCGTCGGTGTTCGCTTTCGGGCGGACCAAGAGGGAATGCGGTGCGGGAGTTTCTCCCAAAGCCGCGGCTGCCCCCGCAACTGTCGGCGGTGAGCGGGCCTGCAACATGCCACTGGAGCAATCCGGGAAGGCGCAGGCTTCGCAATGACCCGCGAGCCAGGAGACCTGCCGGCGACATCCTGCCCGTTCA
Xaut_3288 cfrX -280 113 CTTTAGTGCCCCTGTCGAAGGTCCCGTGGTCCCACACGGGCGCAAAAGGGAATGCGGTGCGGGAGGTCTCTCCCAATGCCGCGGCTGCCCCCGCAACTGTAAGCGGTGAGCCCCTGCCACATGCCACTGTCGCCGCAAGGCGCCGGGAAGGCGGTGGGGGCGCTGATCCGCGAGCCAGGAGACCTGCCTTCGACAAGGTCCGCGCC
Xaut_0420 cbtC -264 89.9 CTGCTGCAAAGGCACATGGTTTTCCATCGGCGCGCGGCGACGCGCTTCGATGGATCTGGGAACGGGGAAGGGCCTGACCGCCCGAAGCCCCGACCGCCCCCGCGACTGTGAGCGGCGAGTGGCCTTCCACGATGCCACTGGACCTGAGCCTTTCGAGGCCGGGTCTGGGAAGGCGGATGGTTGCGACGACCCGCAAGTCAGGAGACCGACCATGGGCATGTGTTCACCCTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD