Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Chlorobiales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Chlorobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chlorobium chlorochromatii CaD3
Cag_1014 btuB7 -487 68.6 TGTTCTTTTACTTGTAACTGGTGTCGGTTTAAAAGCCGAAGAATAGGGAAGTACGTGAAAGTCGTACACTGTACCCGCAACTGTACAACGGTTCGCTGCTTGCTTGCTTTTGCATTGCCCAATGCTTGAGTAACAGCAGTCTTTGTGAGTCACTGCAACGTTTCGCCTCATTGAAACTTGTGGGAAGGCTTGTAAAGCTTTGGAATGCCGTAATAGTCAGGAGACCTGCCAGTTATTTTGCTCTCAAT
Pelodictyon phaeoclathratiforme BU-1
Ppha_1262 btuB7 -512 75 GTTCTTTCGTCGTAGCTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAATTACGTGAAAATCGTAAACTGTACCCGCAACTGTACAACGGTAAGCTGCCAATAACACTCCATGGCCATCATGGATTGTCGAAAGCAGTCGTTTCAGGTCACTGCACTCTTTTCCTCCCTGGAAAACTGCGGGAAGGCCTGCAACAGTATGAAGCCGTTATAGTCAGGAGACCTGCCAGTTATTTTTGCATTACAAG
Ppha_2623 null -326 100.1 TTTTTTACTGATGAAGCAGGATACCCCATTACAAGGGGTTTAATAGGGAATCACGTGAAAATCGTGAGCTGACGCGCAACTGTAAAGCCGATCACGTGTTGTGCAGCGTTATACCACTGTTCCGTTTGATGCGGAATGGGAAGGTGCTGCACAACCGGCAAGCCAGGAGACCTGTCCCGCTTCTTTTCTTGTAA
Chlorobium ferrooxidans DSM 13031
CferDRAFT_0905 btuB7 -493 73 TTGTTCTTTCGTCGTAGCTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAATTACGTGAGAATCGTAAACTGTACCCGCAACTGTACAACGGTAGCCGCAACAAGCGGAGCATGGCCACATGCTCAAGCTCTTTGTGGCAGTTTCAGGTCACTGCATGTTCTCCTCCAGGGAGAGCGGCGGGAAGGCCGGAACAGATTGAGACCGTGATAGTCAGGAGACCTGCCAGTTATTATTTGCATTAC
Chlorobium phaeobacteroides DSM 266
Cpha266_1115 btuB7 -618 76.2 TCTTTCTGTTCGTAGCTGGTGCCGGCTTAAAAGCCGGAGAATAGGGAAGTACGTGAAAATCGTACACTGTACCCGCAACTGTACAACGGGAAATTGCCGCAGTCACTCATGGCCACATGTATGACAGCCGCAGTCGTTTCAGGTCACTGCATGTTTTCCATCCCCGGAAAACGGCGGGAAGGCCGAAACGGAAGTAAACCGTGATAGTCAGGAGACCTGCCAGTTATTTTTGCGTGAAAAG
Chlorobium limicola DSM 245
Clim_1064 btuB7 -492 74.8 GTTCTTTCGTCGTAGCTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAAGTACGTGAAAGTCGTACACTGTACCCGCAACTGTACAACGGTATACTGCTGAAGTCGTTCATGGCCACATGCATGAGGACGGCAGTCGTTTCAGGTCACTGCATCGTTTTCCGCCCAGGAAAACTGCGGGAAGGCCGGAACGGAGACAAGCCGTGATAGTCAGGAGACCTGCCAGTTATTTTTGCATTACAAG
Clim_1023 btuB4 -499 96.6 TAAGTAATAACAGTTACGGTTTCCGGCGCCTGGAAGGGCGCCGGAATGAAAAGGGAACCCGGTGAAAATCCGGGACAGTGCCCGCTGCTGTGATCCCCCCGTCGGCATCTGCCGGCGGCGCGGTGCTTCCGAAAAGGCCACTGGTCCGCGCCTGCGGACCGGGAAGGCCGGAAGCATGGGGAGAGTCAGAAGACCTGCCGTAACGAAGTAATGCTTCGG
Clim_1001 btuB7 -509 74.7 TCTTTCTCGTCATAACAGGTGCCGGCTTGAAAGCCGGAGAATAGGGAAGTACGTGAGATTCGTACACTGTACCCGCAACTGTACAACGGTAAACCGCCGATCAGAGCACATGACCTTGTGTGCACGAAAAGCGGTCTTTTCAGGTCACTGCGCTGTTTTCCTCCCAGGAAAAGCGCGGGAAGGTCTGAAAAGGATGTAAACCGTTAAAGTCAGGAGACCTGCCGGTTATGCTATTGCAATCAA
Clim_1057 nrdD -2702 98.8 TTTTACTGATGAAGCTGGATACCCCATAAAAAGGGTTTAATAGGGAATCACGTTAAAATCGTGAGCTGACGCGCAACTGTAAAGCCGATCGAGTGTTGTGCAGCGTTATACCACTGTTCCGAACGATACGGAATGGGAAGGTGCTGCAGAACCGGCAAGCCAGGAGACCTGTCCCGCTTCTTTTCTTGTAACA
Prosthecochloris vibrioformis DSM 265
Cvib_0807 nrdD -356 78 TTCTTTCATTGTATGCTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAACTGCGTGAAAATCGCAGACTGTACCCGCAACTGTATGACGGTAAGCCCTGAAACTACTGCATGACAACATGCACCTATTTCCGGGTTCGTTCCAGGTCACTGCATTGTTTTCCTCACAGGAACACAGCGGGAAGGCCGGAATGGAAGGGCACCCTCAAAGTCAGGAGACCTGCCAGCATGTATCGCATCAATCA
Cvib_0812 btuB7 -302 75.1 GTTCTTTCAGCGTAGCTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAATTGCGTGAAAATCGCAGACTGTACCCGCAACTGTATAACGGTAAGCCAGGAAATCACTGCATGGCCACATGCATCGGTTTCAGGGTTCGTTCCAGGTCACTGCATCGTTTTCCTCCACGGAAAACAGCGGGAAGGCCGGAATGGAAGTAAGCCGTGAAAGTCAGGAGACCTGCCATCTGCCATTTGCAACAAAA
Cvib_0806 null -248 92.8 ATCATACTTGAACCTGCGGTGCCGGAATCGGAAATGAGACCGGCTTAATAGGGAACCCGGTGTGAATCCGGGACAGTCCCCGCTGCTGTAATCCTGCGCCTTCGCTTGCTTGAGCAAGGTGAAAAGGTTCCGTCAATTATGCCACTGTACCGAAACATTCGGGACGGGAAGGCTGCCGGAATCCGGGAAAGTCAGAAGACCTGCCGCAATTATTTCTTCCATGCT
Cvib_0810 aldH -317 82 CTGATGCATGAGGTGACGGTTGTCGTTTTCGCAGTATCCAGGAACACGGTGTGAATCCGTGGCGGTCCCGCCGCTGTAACCGGGGACTGAACCTGCACTGAGACCCCTTTGGGGGTGGTCACTGTTCCGGCTTACCGGAATGGGAAGGCTTGCAGGGGAGGACTGATCCGGAAGCCAGAAGACCTGCTGTGACTGACTGTTACATATT
Pelodictyon luteolum DSM 273
Plut_1145 null -247 93.7 CCTGCAAATCTAGACTTGTGGTGCCTGAATATGGAAACATCGAAGGCGTAATAGGGAACCCGGTGTAAATCCGGGACAGTACCCGCTGCTGTAATCCTGCATCCCCCAAGGGAGATGGAAAGGTTTCTGCAACAATGCCACTGTTCCAAACAAAAATGGAACGGGAAGGCTGCAGGAATTCGGGAAAGTCAGAAGACCTGCCGCAACTATTTCGTGAACG
Plut_1144 aldH -313 73.8 CATTACCTTTGCAATGAGTGGTTGCATAGCATCCAGGAACACGGTGTGAATCCGTGGCGGTCCCGCCGCTGTAACCGGGAACTGAACCTGCACAAGATCCCCGGAAGGGGATGGTCACTGTTCCGGCATACCGGAATGGGAAGGTCTGCGGGGGAGGAATGATCCGGGAGCCAGAAGACCTGCTGTGACGAACCCTTACCAA
Plut_1142 btuB7 -487 78.7 TTGTTCTTTCAGCGTAGCTGGTGCCGGTTTAAAAACCGGAGAATAGGGAACTGCGTGAAAATCGCAGACTGTACCCGCAACTGTATAACGGTAAGCCACGAAATCCCTGCATGGCCACATGCATCGGTTTCAGGGTTCGTTCCAGGTCACTGCATCGTTTTCCACCTCGGAAAACAGCGGGAAGGCCGGAATGGAAGTAAGCCGTCAAAGTCAGGAGACCTGCCATCTACCATTTGCATAAA
Chlorobaculum parvum NCIB 8327
Cpar_1207 Cpar_1207 -244 94.4 ATACTTTACACGAGCATGTGGTGCCCGGCATGGAATCGTGACGGGCTTAAAAGGGAATCCGGTGCAAGTCCGGAACAGTACCCGCTGCTGTAATCCCGCATCGGTCGCAAGGCTGCTGACACGGTTTGCCGAAAAGGCCACTGTCCCGACAATTCGGGACGGGAAGGAGGGCAAAACCACGGGAAAGTCAGAAGACCTGCCGCATCTTTTTTTACAAGC
Cpar_1184 btuB7 -451 72.4 GTTCTTTTACATGATAGCTGGTGCCGGTTTTAAAGCCGGAGAATAGGGAAGTACGTGAGATTCGTACACTGTACCCGCAACTGTACAACGGCAAGCTGCCGCTGACGAACATGGCCACATGTCCGGATGCTGCAGTCGGTGCGCGTCACTGCCAGGCTCCTCCAGGGAGCGGGTGGGAAGGCCGTACTGCTTGAGCCGCCAAAGTCAGGAGACCTGCCAGTTAGCTCTTTGCTCAG
Cpar_1485 porB -616 91.8 ATACTTCATCCGAACATGTGGTGTCTGTCATCGCGAGATGACGGGCTTAAAAGGGAATCCGGTGAAAGTCCGGAACAGTACCCGCTGCTGTAATCCCGCACCGGCTGCAAGGCTGGTGAAAAGGTTCGCCAACAATGCCACTGTCCCAGTTTTGGGATGGGAAGGCTGGTGAAACCCGGGAAAGTCAGAAGACCTGCCTCATTTTTTTAACGCTTC
Chlorobium phaeobacteroides BS1
Cphamn1_1191 nrdD -359 101.8 GATTTTTGATAAAGCAGGATACCCCTTGACAGGGGTTTAAAAGGGAATCACGTGAGAATCGTGAGCTGACGCGCAACTGTAAGCCCACCGAGATGTTTTGCGGCAAAGTGCCACTGTCCCGATGAACGGGATGGGAAGGCGTCGTAAAACGGGTAAGCCAGGAGACCTGTCTTGTTTTTTATCCGGAAGCA
Cphamn1_1519 btuB7 -459 75.4 TGTTCTTTCTTTTATGACTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAAGTACGTGAGATTCGTACACTGTACCCGCAACTGTAGACGCGGTCAACTGTTGTTTTTTTGCATGGCCTCATGCCAGGAAATAACAGGCGCTATTGATCACTGTGATTTTTCCTCCCGGAAAAGCGCGGGAAGGTCAACAGCATAAGTATGCCGCAAAAGTCAGGAGACCTGCCAGTTATTCATTGCTTGTT
Prosthecochloris aestuarii DSM 271
Paes_1272 metE -197 97.6 TTTCTTATTGGTGAAGCTTGATACCCTGTAAAAAGGGTTTAATAGGGAATCACGTGCAAATCGTGAGCTGACGCGCAACTGTAAAGCCGATTGAATGTTGTGCAGCGTTATGCCACTGTTTCGCCTCTTGCGGAACGGGAAGGTGCTGCAGAACCGGCAAGCCAGGAGACCTGTCCTGCTTCTTTTTCTCTAA
Paes_1274 btuB4 -243 93.6 GTGATTTTGTAAACCTTGCGGTGCCCTGGCTGGTCAGTCCTGCCGGGCTTAAAAGGGAATCCGGTGAAAATCCGGAACAGTTCCCGCTGCTGTAATCCCCTTCCGGTCTTCGGACCGGAACATCACAGTCTGCAGAGAGAGCCACTGTCGCGCACCCCGCGCAACGGGAAGGCCTGCAGACCGGGGGAGAGTCAGAAGACCTGCCGTAATGGAGAATGCTTCG
Paes_0325 porB -440 93.8 GATATCAGAAATACTGTGGTGCCGGTCATCTCTCCTGACCGGTTTAAAAGGGAATCCGGTGAAAATCCGGAACAGTACCCGCTGCTGTAATCCTGTACCGGTGTTAAACCGGTGAGCTATGTTCATCAAAGATGTCACTGACCCGAGCCCTCGGGTCGGGAAGGCTGATGAAATCAGGAAAGTCAGAAGACCTGCCCCGGTATTATTTCGCTTCGG
Paes_0906 nrdD -355 94.1 TTGTATTGGGGAAGCTGGATACCCTGTAAAAGGGGTTTAATAGGGAATCACGTTCAAATCGTGAGCTGACGCGCAACTGTAAGTCCCAGGATATTTCTGCAGCATTGTGCCACTGTGCCGTTATACCGGCGCGGGAAGGCGCTGCAGAAGGGATGAAGCCAGGAGACCTGTCCTGTTTTCTTTGTTTTCCAT
Paes_1271 btuB7 -454 76.5 TGTTCTTTCTCTTGTAACTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAAGTACGTGAGATTCGTACACTGTACCCGCAACTGTAATAACGGTATGCTTCAGTTTATTCTGTCATGGCCACATGACAATAAAGCTGGAGTTTTTCCTGGTCACTGCGTCGTTGATTTCCTCCCGGAAATCCGCGGGAAGGCCCGGAGAGCAGATGTAACCGTTTAGAGTCAGGAGACCTGCCACGTTATTATTTCTATGC
Paes_1282 btuB3 -476 74.9 ATTGTTCTTTCTCGACCGGTGCCTGTTGCTACAGGGTAAAAGGGAATTGCGTGAAAATCGCAAACTGTACCCGCAACTGTCATTACTGGAACCGATCATCTCCTTCGACCGGTTCAATTGCGTGAACGTGTATCACTGCGTCAACCTTGTGTCCATCCCGGACAGCGCGGGAAGGTATTCGTTCAGATTACTTCTATCAGTAAGAGTCAGGAAACCTGCCGGTTGATTATTGCCTGAAAA
Paes_1301 btuB7 -518 81.9 TGTTCTTTCGCTTGTAACTGGTGCCGGTTTAAAAGCCGGAGAATAGGGAAGTACGTGAGATTCGTACACTGTACCCGCAACTGTAATAACGGTATGCTTCAGTTTATTCTGTCATGGCCACATGACAATAAAGCTGGAGTTTTTCCTGGTCACTGCGTCGTTGATTTCCTCCCGGAAATCCGCGGGAAGGCCCGGAGAGCAGATGTAACCGTTTAGAGTCAGGAGACCTGCCAGTTTCAATTGCATCATA
Chloroherpeton thalassium ATCC 35110
Ctha_2451 btuF -235 94.4 AAATAACGGCCTGTTACACGGTGTTGTTCTTAGCCAACTTAAAAGGGAATCCGGTGAAAGACCGGAACAGTCCCCGCTGCTGTAATCCTGCATTGAATTTTGAAATAAGATTCAATGGAGTAATCTGACAAAAAAAGCCACTATTCTAAGGATGGGAAGGCTGTCGGATTCGGGAAAGTCAGAAGACCTGCCGTGAGATATATTTTTCAT
Ctha_1003 btuB6 -415 79.4 ATATCTACGCTTATTCTTGTTCTTTATTTTTTGCGACGATAATCATCATCAGGGAATTCGGTGAGAATCCGAGACTGTACCCGCAACTGTGATAACCGTTAAGTCGAATTGCAAAAAGCCATTGCGAAAGTGAGAAGGCGCGATTCGAAGGTTTAAGTCAGGAGACCGGCAAAACTAAATTAATCTTAATG
Ctha_2117 btuB5 -405 89.8 TTCTTTAGAAACTGTTCGGTGCCCTTCATAAGGGAAGGGATAATAGGGAATTGTGTGAAAATCGCAAACTGTTCCCGCAACTGTAATTTGTGGATGTCTGGTTTCCAAAAGCCAGATGAAAGCTTAGCCGTCACTGTGTGTTTGCCAGCCTTGGCAGCGCGGGAAGACTTAAGCTATAACCATTACTTCGCTTGAAGTAACCACAAGAAGTCAGGAGACCTGCCGAACTGATTTTGCAAGCGCA
Ctha_2210 btuB3 -464 80.6 AATTTTGAGTTTTATCTGGTGCCTGTTTTCACAGGGTAAAAGGGAATTGCGTGAAAATCGCAAGCTGTACCCGCAACTGTAAAATACATCTGTTTTTGAGTGAAAATTGCTGCTAAGCATTTTTCCTCATCAACCGCTAACCGCGCCACTGCGCTCGCCCACTCAAGGCTGCGTGGGAAGGCCGGCAAAGCATTTCCGGTAATAAGTCAGGAAACCTGCCAGATAAATTTCATTGCACGA
Ctha_2234 btuF -227 93.6 GTATAATTTCCCTTCTTGCGGTGTTGCGTTAGGCAACGAATAGGGAATTCGGTGAAAGTCCGAGACAGTCCCCGCTGCTGTAATCCTGCATTGATTTTCGTTTTATCAATGGAGCAATCCGGCGAGTAAGCCACTTTCTTTGGAAGGGAAGGCCGATCGGATTCGGGAAAGTCAGAAGACCTGCCGCAAAATATTTTCATTCG
Ctha_0685 nrdD -133 18.6 GGAAGTCCTGTGAGAATCAGGCACAGTCGCGCTACGGTATTGAGTTGCCGGCGATCCTGGCACGCTAAGTCCGAGTACCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD