Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CggR in Lactobacillaceae

Properties
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-bisphosphate
Regulog: CggR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA0697 cggR 1 8 TGGATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC
Lactobacillus brevis ATCC 367
LVIS_0660 cggR 1 6.5 TGCATGAGGATTGGCAATGGGTAGAGGCCATCATGCC
Lactobacillus casei ATCC 334
LSEI_0966 cggR 1 7.6 TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0566 cggR 1 6.9 TGAACACGGATTTATCCCTGCTCGAACTGCTTGTTCC
Lactobacillus helveticus DPC 4571
lhv_0742 cggR 1 7.9 TGAATTCGGACTTTTCTTTGCTCGAAGCGCTCGTTCC
Lactobacillus johnsonii NCC 533
LJ0871 cggR 1 6.1 TGGACTCGGATTTAACCTTGTTGCAAAGCTTAGTTCC
Lactobacillus plantarum WCFS1
lp_0788 cggR 1 6.7 TGCATTCAGATATTCAATGGATTGAGGCAATTGCCCC
Lactobacillus rhamnosus GG
LGG_00932 cggR 1 7.6 TGCATACTGAACTTGCGTGGCTCAAAGCGATCGCGCC
Lactobacillus sakei subsp. sakei 23K
LSA0603 cggR 1 6.5 TGCGCGATGAGTTATCTGCAATAGAAGCGGTTGCGCC
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1167 cggR 1 6.8 TGCGCGAGGAAGTAGAGTTGATTGAGTCAATCGTTCC
Pediococcus pentosaceus ATCC 25745
PEPE_0458 cggR 4 6 ATGATAATGAGATGGATTTATTAGAATCTGTTGTTCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD