Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SPy1285 in Streptococcaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: SPy1285 - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG0938 SPy1285 -51 6.5 TTGTACTATTTTTATAGTACAA
SAG0279 SAG0279 -56 5.3 TTGTATATATAAAATAATACAA
SAG1361 SPy0836 -35 6.2 TTGTTCTATATTAATAATACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1097 SPy1285 -51 6.4 CTGTACCATTTATTTAGTACAA
SDEG_1734 SAG0279 -39 5.1 TTGTATTAGCGTAAAAGTACAA
SDEG_0798 SPy0836 -37 6.6 TTGTCTTATAAAAATAGTACAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0879 SPy1285 -58 6.8 TTGTATCATTTAATTAGTACAA
Sez_1122 SPy0836 -37 6.2 TTGTCTTAAAAAAATAGTACAA
Sez_1597 SAG0279 -39 4.5 TTGTATTAGCGTAAACGTACAA
Streptococcus gallolyticus UCN34
GALLO_0987 SPy1285 -57 6.1 CTGTACCATTTATGTAGTACAA
GALLO_1332 SPy0836 -48 5.6 TTGTCTTATCGCAACAATACAA
GALLO_0401 SAG0279 -43 5.7 TTGTGTTACTTTAATAGTACAA
Streptococcus gordonii str. Challis substr. CH1
SGO_0798 SAG0280 -42 4.1 ATATATAATAAATATATTATAA
Streptococcus mitis B6
smi_0839 SPy0836 -153 6.5 GTGTATTATATATCTAGTACAA
smi_0581 SPy1285 -46 6.7 TTGTATTATTTAATTAAGACAA
Streptococcus mutans UA159
SMU.1193 SPy1285 -52 6.6 TTGTATTATATATATAACACAA
SMU.862 SPy0836 -112 5.9 TTGTATTATAGCCTTAAGACAA
SMU.1041 SAG0280 -46 5.4 TTGTATGATTTCAGTAGTATAA
Streptococcus pneumoniae TIGR4
SP_1714 SPy1285 -46 6.7 TTGTATTATTTAATTAAGACAA
SP_1381 SAG0280 -57 4.3 TTGTATCAAAGTGCTAGTATAG
SP_0785 SPy0836 -129 6.5 GTGTATTATATATCTAGTACAA
Streptococcus pyogenes M1 GAS
SPy1285 SPy1285 -51 6.5 CTGTACCATTTAATTAGTACAA
SPy1675 SAG0279 -39 5.1 TTGTATTAGCGTAAAAGTACAA
SPy0836 SPy0836 -37 6.5 TTGTCTTATACAAATAGTACAA
Streptococcus suis 05ZYH33
SSU05_0513 SPy0836 -28 5.9 GTGTATTATATAGACAACACAA
SSU05_0748 SAG0280 -124 5 TTGTACTAATTCAGCAGTATAA
SSU05_0541 SPy1285 -48 5.9 TTGTATTATTAAGATAAGACAT
Streptococcus thermophilus CNRZ1066
str1435 SPy1285 -59 6.3 TTGTATCATTACTTTAGTACAA
Streptococcus uberis 0140J
SUB1003 SPy1285 -54 6.5 CTGTACCATTTAAATAGTACAA
SUB1426 SAG0279 -34 5.7 TTGTATTAGATTAAAAGTACAA
SUB0736 SPy0836 -37 6.5 TTGTCTTATATTAATAATACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD