Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator YjdR in Streptococcaceae

Properties
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Regulog: YjdR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG1332 yjdR -35 6.4 ATAGTTCTCACGGTAACTAT
SAG1707 yjdE -144 6.6 ATAGTTCTCACGATAACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1978 yjdR -55 6.4 ATAGTTATCCAGAGAACTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0219 yjdR -52 6.3 ATAGTTCCCAAGAGAACTAA
Sez_0219 yjdR -31 6.1 ATGGTTATCATGAGAACTAA
Streptococcus gallolyticus UCN34
GALLO_1290 yjdR -71 6.7 ATAGTTCTCATAAGAACTAT
Streptococcus gordonii str. Challis substr. CH1
SGO_1752 yjdR -37 5.9 TTTGTTCTCAAGAGAACTAA
SGO_1752 yjdR -57 6.1 ATAGTTCTCACGGTAACTTA
Streptococcus mitis B6
smi_1836 yjdR -117 6 ATAGTTCTCTAGGAAACTTT
smi_1836 yjdR -66 6.2 ATAGTTCTCATGGAAACTTA
Streptococcus mutans UA159
SMU.921 yjdR -52 6.5 ATAGTTTTCATGAGAACTAT
Streptococcus pneumoniae TIGR4
SP_1920 yjdR -42 5.9 ATTATTCTCCAGAGAACTAT
Streptococcus pyogenes M1 GAS
SPy0228 yjdR -282 6.4 ATAGTTATCTAGAGAACTAA
Streptococcus sanguinis SK36
SSA_0460 yjdR -89 6.2 ATAGTTCTCATGGAAACTTT
SSA_0460 yjdR -39 6.6 ATAGTTCTCACGAAAACTAT
Streptococcus suis 05ZYH33
SSU05_2039 yjdR -40 5.9 ATAGTTCTCATGGTAATTAT
SSU05_2039 yjdR -61 6.6 ATAGTTCTTAAGAGAACTAT
Streptococcus thermophilus CNRZ1066
str0432 yjdR -58 6.4 ATAGTTCTTATAAGAACTAA
Streptococcus uberis 0140J
SUB1690 yjdR -51 6.5 ATAGTTCTCTTAAGAACTAA
SUB1642 yjdE -87 6 ATAGTTCTCAGGGTAACTAT
SUB1690 yjdR -30 5.9 ATGGTTTTCACGAGAACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD