Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Lactobacillaceae

Properties
Regulator family: NrtR
Regulation mode:
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus casei ATCC 334
LSEI_2767 pncA -40 6.3 TTTAAGTAAAAAATACTTTTA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0279 pncA -55 6 TTTAGGTAAGTTATACTTTTA
Lactobacillus fermentum IFO 3956
LAF_1390 pncA -54 6 TTTAGGTATTTTTTACTTTAA
Lactobacillus helveticus DPC 4571
lhv_0930 pncB -74 6 TAAAAGTAACTTAGACTTTTA
Lactobacillus plantarum WCFS1
lp_2514 niaP -61 5.8 TAAAGGTAAAAAATACCTAAA
Lactobacillus reuteri JCM 1112
LAR_0148 pncB -75 6.1 TAAAAGTTAATCATACTTTTA
Lactobacillus rhamnosus GG
LGG_02764 pncA -41 6.5 TTTAAGTAAATTTTACTTTAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0911 niaP -40 6.4 TAAAAGTAAAAAATACTTTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD