Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NagR in Streptococcaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1667 nagB -39 6.1 AAATTGATATATACCAATTT
LACR_1094 glmS -47 5 ATAATTAAATATACCAATTT
LACR_1458 nagA -74 5.6 TAATTGGTATATACTGTTTA
Lactococcus lactis subsp. lactis Il1403
L33556 glmS -47 5 ATAATTAACTATACCAATTT
L33556 glmS -155 5.2 AAAATAAATTATACCAATTA
L14408 nagB -38 6.1 AAATTGATATATACCAATTT
L173068 nagA -74 5.6 TAATTGGTATATACTGTTTA
Streptococcus agalactiae 2603V/R
SAG0799 nagB -34 5.7 ATAAAGGTCTATACCAAATA
SAG0799 nagB -62 6.5 AAATTGGTATATACCATATA
SAG0944 glmS -75 5.2 ATATTAATATATACCAATTC
SAG0266 nagA -67 6.4 AAATAGGTATATACCATTTA
SAG0944 glmS -153 5.4 CAAAAAGACTATACCAATTT
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1443 nagB -64 6.5 AAATTGGTATATACCATATA
SDEG_1443 nagB -35 5.6 TAAAAGGTCTATACCAATAA
SDEG_1751 nagA -67 6.2 TAAGTGGTATATACCATTTA
SDEG_1092 glmS -146 5.4 CGATTAGACTATACCAATTT
SDEG_1092 glmS -68 5.1 TCTAAGGACTATACCAATTA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0884 glmS -148 5.7 AAATATGACTATACCAATTT
Sez_0658 nagB -63 6.4 TAATTGGTATATACCATATA
Sez_0658 nagB -34 5.3 CAAAAGGTCTATACCAATCA
Sez_0477 nagA -68 5.4 GGACTGGTATATACCATTTA
Sez_0884 glmS -69 5.3 ATATCTGACTATACCAATTA
Streptococcus gallolyticus UCN34
GALLO_0666 nagB -43 4.8 TAAGAGGTCTATACCAAAAC
GALLO_0666 nagB -74 6.5 AAATTGGTATATACCATATA
GALLO_0390 nagA -69 6.4 AATTTGGTATATACCATTTA
GALLO_0992 glmS -157 5.1 TAATTGGTATATACAAAACT
GALLO_0992 glmS -69 5.8 TTATTAGACTATACCAATTT
Streptococcus gordonii str. Challis substr. CH1
SGO_1757 glmS -65 5.8 AAATCAGACTATACCAATTT
SGO_1586 nagB -52 6.5 AAATTGGTCTATACCATATA
SGO_0549 nagA -118 6.4 AAATAGGTCTATACCATTTA
Streptococcus mitis B6
smi_0714 nagB -51 6.5 AAATTGGTCTATACCATATA
smi_0202 nagA -95 6.4 AAATAGGTCTATACCATTTA
smi_1850 glmS -136 5.8 AATTTGAACTATACCAATTT
smi_1850 glmS -96 4.9 AAACAAGTATATACTGTTTT
smi_1850 glmS -57 5.9 GAATTAGACTATACCAATTT
Streptococcus mutans UA159
SMU.636 nagB -30 4.7 CTATTTGTATAGACCGATTA
SMU.636 nagB -50 6 AAATTGGTCTATACCTTATA
SMU.435 nagA -43 6.4 AATTTGGTATATACCATTTA
SMU.1187 glmS -148 5.4 CAAAAAGACTATACCAATTT
SMU.1187 glmS -71 5.8 TTATTAGACTATACCAATTA
Streptococcus pneumoniae TIGR4
SP_1415 nagB -51 6.5 AAATTGGTCTATACCATATA
SP_2056 nagA -95 6.4 AAATAGGTCTATACCATTTA
SP_0266 glmS -57 5.9 GAATTAGACTATACCAATTT
SP_0266 glmS -96 4.9 AAACAAGTATATACTGTTTT
SP_0266 glmS -136 5.8 AATTTGAACTATACCAATTT
Streptococcus pyogenes M1 GAS
SPy1399 nagB -35 5.4 CGAAAGGTCTATACCAATTA
SPy1399 nagB -64 6.5 AAATTGGTATATACCATATA
SPy1694 nagA -68 6.3 AAAGTGGTATATACCATTTA
SPy1280 glmS -150 6.1 TAATTAGACTATACCAATTT
SPy1280 glmS -72 6.2 TAATTAGACTATACCAATTA
Streptococcus sanguinis SK36
SSA_2107 glmS -147 5.3 AAAGAAAACTATACCAATTT
SSA_0746 nagB -51 6.5 AAATTGGTCTATACCATATA
SSA_2107 glmS -69 5 CAAGTATACTATACCAATTT
SSA_1893 nagA -174 6.4 AAATAGGTATATACCATTTA
Streptococcus suis 05ZYH33
SSU05_0634 nagB -28 5.3 AAAATGGTATAGACCAAAGA
SSU05_0634 nagB -60 6.5 AAATTGGTCTATACCATATA
SSU05_0549 glmS -57 5.9 AAATTAGACTAGACCAATTT
SSU05_0549 glmS -135 6 AAATTAGACTAGACCAATTA
Streptococcus thermophilus CNRZ1066
str0541 nagB 42 5.8 AAAATGGTATATACCAATAT
str0873 glmS -107 4.4 TATATGGAATATACTGTCTT
str0873 glmS -68 4.8 CTTATTGACTATACCAATTT
Streptococcus uberis 0140J
SUB1239 nagB -31 5.6 TAAAAGGTCTATACCAATAA
SUB1239 nagB -60 6.5 AAATTGGTATATACCATATA
SUB0998 glmS -67 5.5 TTATTTGACTATACCAATTT
SUB0998 glmS -145 5.8 AAATTAGACTATACCAATAA
SUB1443 nagA -67 6.2 AAACTGGTATATACCATTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD