Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ScrR in Lactobacillaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA0400 scrB -80 6.2 TATGATAAACGTTTGACACA
LBA0401 scrA -174 6.1 TGTGTCAAACGTTTATCATA
LBA0401 scrA -86 6.5 TGTGTCAAACGATTGACATA
LBA0400 scrB -168 6.4 TATGTCAATCGTTTGACACA
Lactobacillus fermentum IFO 3956
LAF_1580 scrB -73 5.5 TATGCTAATCGATTGACAGC
LAF_1578 scrA -106 5.9 TATGTCAAACGGTTGACAAT
Lactobacillus johnsonii NCC 533
LJ0518 scrB -164 5.9 TATGTCAAGCGCTTATCATA
LJ0518 scrB -87 5.3 ACTGTTATTCGTTTGACATA
LJ0519 scrA -91 6.1 TATGATAAGCGCTTGACATA
LJ0519 scrA -168 5.7 TATGTCAAACGAATAACAGT
Lactobacillus plantarum WCFS1
lp_0187 scrB -171 6 TATGTCAAGCGTTTGATACA
lp_0187 scrB -82 6.4 AATGTCAAACGATTGACATA
lp_0185 scrA -193 6.5 TATGTCAATCGTTTGACATT
lp_0185 scrA -104 6.1 TGTATCAAACGCTTGACATA
Lactobacillus sakei subsp. sakei 23K
LSA1793 scrB -77 5.9 AATGACATACGTTTGACATA
LSA1792 scrA -169 6.1 TATGTCAAACGTATGTCATT
LSA1792 scrA -101 6.3 TATGATAATCGTTTGACATA
LSA1793 scrB -145 6.2 TATGTCAAACGATTATCATA
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0065 scrB -81 5.9 TATGTTATACGATTGACAGT
LSL_0066 scrA -107 6.2 TGTGATAAACGATTGACATA
Pediococcus pentosaceus ATCC 25745
PEPE_0519 scrB -171 6 TATGTCAAGCGTTTGATACA
PEPE_0519 scrB -82 6.4 AATGTCAAACGATTGACATA
PEPE_0518 scrA -104 6.1 TGTATCAAACGCTTGACATA
PEPE_0518 scrA -193 6.5 TATGTCAATCGTTTGACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD