Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ScrR in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG1691 scrB -111 6.8 TATGTCAAGCGTTTGACATA
SAG1690 scrA -93 6.8 TATGTCAAACGCTTGACATA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1872 scrB -110 6.8 TATGTCAAGCGTTTGACATA
SDEG_1871 scrA -152 6.8 TATGTCAAACGCTTGACATA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0363 scrA -185 6.8 TATGTCAAACGCTTGACATA
Sez_0362 scrB -113 6.8 TATGTCAAGCGTTTGACATA
Streptococcus gallolyticus UCN34
GALLO_1893 scrB -109 6.3 TATGTCAAGCGTTTATCATA
GALLO_1892 scrA -109 6.4 TATGATAAACGCTTGACATA
Streptococcus gordonii str. Challis substr. CH1
SGO_1857 scrA -108 6.2 TCTGCAAAACGCTTGACATA
SGO_1858 scrB -111 6.2 TATGTCAAGCGTTTTGCAGA
Streptococcus mitis B6
smi_1615 scrA -108 6.2 TCTGCAAAACGCTTGACATA
smi_1616 scrB -108 6 TATGATAAACGTTTGACAGT
Streptococcus mutans UA159
SMU.1843 scrB -112 6.4 TATGTCAATCGTTTTACATA
SMU.1841 scrA -103 6.4 TATGTAAAACGATTGACATA
Streptococcus pneumoniae TIGR4
SP_1722 scrA -109 6.2 TCTGCAAAACGCTTGACATA
SP_1724 scrB -286 6.2 TATGTCAAGCGTTTTGCAGA
Streptococcus pyogenes M1 GAS
SPy1816 scrB -109 6.1 TATGTCAAGCGCCTAACATA
SPy1815 scrA -152 6.2 TATGTTAGGCGCTTGACATA
Streptococcus sanguinis SK36
SSA_0456 scrA -104 6.2 TCTGCAAAACGCTTGACATA
SSA_0455 scrB -110 6.2 TATGTCAAGCGTTTTGCAGA
Streptococcus suis 05ZYH33
SSU05_1817 scrA -107 6.1 TGTGATAAACGTTTGACATA
SSU05_1818 scrB -1 6 TATGTCAAACGTTTATCACA
Streptococcus thermophilus CNRZ1066
str1735 scrB -106 6.2 TATGTCAAACGTTTAGCATT
str1734 scrA -156 6.1 AATGCTAAACGTTTGACATA
str1735 scrB -52 5.2 TAGGTAAAACGTTTACTATA
Streptococcus uberis 0140J
SUB1543 scrA -96 6.8 TATGTCAAACGCTTGACATA
SUB1544 scrB -108 6.8 TATGTCAAGCGTTTGACATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD