Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CopR in Lactobacillaceae

Properties
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA1963 copR -32 6.1 ATAGTTACATTTGTAAACGA
Lactobacillus brevis ATCC 367
LVIS_0270 copR -68 5.4 ATGACTACAGATGTAGACTC
LVIS_0270 copR -35 6 AAGATTACATTTGTAGTCTA
LVIS_0274 copA2 -139 5.7 AGGATTACATTTGTAAACAA
LVIS_0274 copA2 -184 5.1 TCGTTGACAGATGTAAACGA
Lactobacillus casei ATCC 334
LSEI_A02 copR -46 4.6 GAGACTACAAACGTAAACTT
LSEI_1745 copR -29 6.1 TAGATTACAGATGTAAACGG
LSEI_1745 copR -59 5 TGGTTTACAGTTGTAAATTA
LSEI_A02 copR -77 5.4 GTGACTACAGTTGTAAACTA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0587 copR -31 6 AAGGTTATAGATGTAAACGA
LBUL_0587 copR -72 4.8 TTGTCGACAAATGTAAACCA
Lactobacillus fermentum IFO 3956
LAF_0138 copA2 -80 4.9 TCGTTGACAATTGTAAACGG
LAF_1037 copR -42 4.6 ACGGGTACACTTGTAAACTG
LAF_0138 copA2 -35 5.7 AGATTTACAGTTGTAAACGA
Lactobacillus helveticus DPC 4571
lhv_1944 copB -177 5.4 GTGACTACAGTTGTAAACTA
lhv_2094 copR -32 6.3 ATATTTACAAATGTAAACTA
lhv_1944 copB -146 5.1 GAGACTACAAATGTAAACTT
lhv_2094 copR -59 5.3 AAGTTTACAAATGTAAAATT
Lactobacillus johnsonii NCC 533
LJ1835 copR -61 5.4 TTGTTGACAAGTGTAAACTA
LJ1835 copR -33 6.3 ATGATTACATTTGTAAACGA
Lactobacillus plantarum WCFS1
lp_3363 copB -43 5.9 TAAATTACAGATGTAGACAA
lp_3363 copB -69 4.7 TCGTCTACAATTGTAAACTT
lp_3365 copR -52 5.2 ACGTTTACGGTTGTAAACTA
Lactobacillus reuteri JCM 1112
LAR_0894 copR -32 5.1 GAATTTACATGTGTAAACGC
LAR_0423 copA2 -70 4.6 TTGTTGACAACTGTAAACTT
LAR_0423 copA2 -27 6.4 ATGATTACAATTGTAAACTA
Lactobacillus rhamnosus GG
LGG_01802 copR -29 6.2 AAGATTACAAGTGTAAACGG
LGG_01802 copR -59 5 TCGTTTACAGTTGTAAATTA
Lactobacillus sakei subsp. sakei 23K
LSA1461 copR -35 6.4 ATAATTACAAATGTAAACGA
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1706 copA2 -35 5.4 GTGATTACAAATGTAAATTA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0049 copR -25 5.9 TAGTTTACAGTTGTAGACTA
Oenococcus oeni PSU-1
OEOE_1648 copR -30 5.8 AAGTCTACAAGTGTAGACTA
Pediococcus pentosaceus ATCC 25745
PEPE_1646 copR -35 5.9 AAGATTACATTTGTAAACAG
PEPE_1646 copR -61 6.1 AAGTTTACAAATGTAGTCTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD