Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CopR in Streptococcaceae

Properties
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_0920 copB -65 5.6 AGGTTTACAATCGTAAACTT
LACR_0427 ydiD -106 5.8 ATGTTTACATGTGTAAATTT
LACR_2184 cinD -72 6.2 TAGTTTACAAGTGTAAATTT
LACR_0889 copR -53 5 GTGTTTACGCGTGTAAACTT
LACR_2184 cinD -45 5.6 AAGATTACAGATGTAAACAA
LACR_0891 copA -54 6.1 AAGTTTACAATTGTAAACTA
LACR_0072 yahC -45 5.9 TCGTTTACAATTGTAAACAT
Lactococcus lactis subsp. lactis Il1403
L186107 ydiD -106 5.8 ATGTTTACATGTGTAAATTT
L70979 copB -62 6.1 TAGTTTACAATTGTAAACTA
L174788 cinD -73 6.2 TAGTTTACAAGTGTAAATTT
L174788 cinD -46 5.6 AAGATTACATATGTAAACAA
L45109 copR -53 5.5 GTGTTTACACGTGTAAACTT
L200005 yahC -45 5.9 TCGTTTACAATTGTAAACAT
Streptococcus agalactiae 2603V/R
SAG0384 copR -34 5.3 TGGTTTACAAACGTAAATCG
SAG0384 copR -66 5.8 CGGTTTACAAATGTAGATTT
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1771 copR -41 6.3 TAATTTACAAATGTAAATTA
SDEG_1771 copR -73 5.7 TTATTTACAAATGTAGTTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0447 copR -65 6.2 TTGTTTACAAATGTAAACAA
Streptococcus gallolyticus UCN34
GALLO_0378 copR -43 5.7 AAATCTACAAATGTAAATCA
GALLO_0378 copR -75 5.6 TCGTTGACAAATGTAAACGA
Streptococcus gordonii str. Challis substr. CH1
SGO_0289 copR -75 6.1 TTGTTTACAAATGTAAATGT
SGO_0289 copR -34 6 AGATTTACAAATGTAGATTT
SGO_1935 copR -66 5.7 GCGATTACAAATGTAAACTA
SGO_1935 copR -37 5.9 TGAATTACAAATGTAAATAA
Streptococcus mitis B6
smi_1434 copR -33 6 TAATTGACAAATGTAGATTT
smi_1434 copR -73 6 TAGTTGACAAATGTAGATTT
Streptococcus mutans UA159
SMU.424 copR -31 5.4 GTATCTACAAATGTAGATGA
SMU.424 copR -63 5.8 TTGTTGACAAATGTAGACAA
Streptococcus pneumoniae TIGR4
SP_0727 copR -27 6 TAATTGACAAATGTAGATTT
SP_0727 copR -67 6 TAATTGACAAATGTAGATTT
Streptococcus pyogenes M1 GAS
SPy1717 copR -41 5.9 TAATTTACAAACGTAAATAT
SPy1717 copR -73 5.7 TTATTTACAAATGTAGTTAA
Streptococcus sanguinis SK36
SSA_0139 copR -66 5.9 ACGATTACAAATGTAAACTA
SSA_0139 copR -37 5.9 TAGATTACAAATGTAAATGA
Streptococcus suis 05ZYH33
SSU05_0113 copR -34 5.5 TTGACTACAAATGTAAACTG
Streptococcus thermophilus CNRZ1066
str1586 copR -100 5.3 AAATCTATAAATGTAGATAA
str1586 copR -46 5.9 AAATCTACAAATGTAAACAA
Streptococcus uberis 0140J
SUB1464 copR -34 6.1 ATATTTACAAATGTAAACAA
SUB1464 copR -66 5.9 ATATTTACAATTGTAGATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD