Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR2 in Rhodospirillales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR2 - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acetobacter pasteurianus IFO 3283-01
APA01_16630 iscR2 -42 6.2 AAACAGGACCGCTCAGGTCTTTAAT
Azospirillum sp. B510
AZL_c04260 iscR2 -54 7.1 AATCAGGACTAAATTGGTCCTGTAT
Gluconacetobacter diazotrophicus PAl 5
Gdia_3308 iscR2 -77 7 AATCAGGACTGATTTGGTCCGTTAT
Gluconobacter oxydans 621H
GOX0099 iscR2 -51 6.3 AATCAGGACTTAGCAAGTCTTGAAT
Granulibacter bethesdensis CGDNIH1
GbCGDNIH1_1326 iscR2 -27 6.5 AAACAGGACTTAATTGGTCCAGTTA
Rhodospirillum centenum SW
RC1_0494 iscR2 -81 5.8 AATGTGTACCAGTTTGGTCCGATTT
Rhodospirillum rubrum ATCC 11170
Rru_A2574 iscR2 -45 5.7 AAAGAGTACCAATTTAGTCCTGATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD