Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NiaR in Streptococcaceae

Properties
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG1602 niaX -58 6.4 TACAGGTGTCTTTACACCTGTA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1467 niaX -59 6.1 TATAGGTGTCTTGACACTTGTA
SDEG_1847 pncA -88 4.8 GTTAGTTGTCTTGACACCTGTA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0638 niaX -62 4.2 GCTAGGTGTCTTGACATCTGTC
Sez_0388 pncA -139 5.1 ATCTACTGTCTTGACAGCTGTC
Streptococcus gallolyticus UCN34
GALLO_1936 nadB -177 4.7 GCCAGGTGTCAAGACACCTGTA
GALLO_0647 niaX -191 5.8 TACAGGTGTCTTGACACCTGTG
GALLO_1937 nadA -80 5.6 TACAGGTGTCTTGACACCTGGC
Streptococcus gordonii str. Challis substr. CH1
SGO_1046 niaX -32 6.2 TACTACTGTATATACACATAAA
Streptococcus mitis B6
smi_1196 niaX -33 6.5 TACTAGTGTATATACAGTTAAA
Streptococcus mutans UA159
SMU.332 niaX -67 6.3 AACTAGTGTCTTGACAGATGTA
SMU.946 pnuC -74 5 aAtataTGTCTTgACACaTGTA
Streptococcus pneumoniae TIGR4
SP_2016 nadC -134 6 TACAATTGTCTTGACAATTGTC
SP_2016 nadC -122 5.7 GACAATTGTCTTGACACTTGTT
SP_1233 niaX 20 6.2 TACTAGTGTATATGCAGTTAAA
SP_1859 pnuC -188 4.5 TTTTACTGTAAAGACAGTTGAC
Streptococcus pyogenes M1 GAS
SPy0197 nadC -122 6.2 TACAATTGTCTTGACACTTGTT
SPy1425 niaX -59 5.6 TACAGGTGTCTTGATAGTTATT
SPy1776 pncA -88 4.7 AATAGATGTCTTGATACCTGTA
Streptococcus sanguinis SK36
SSA_1348 niaX -33 6.5 TACTAGTGTATATACAGATAAA
Streptococcus suis 05ZYH33
SSU05_2019 niaX -173 5.8 TACAGGCGTCTTGACACCTGTA
Streptococcus thermophilus CNRZ1066
str0890 niaX 28 6.1 TACTATTGTATTTACAGAAAAA
Streptococcus uberis 0140J
SUB1261 niaX -58 6.3 TACAGGTGTCTTGACACCTGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD