Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DvMF_1994 in Desulfovibrionales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Regulog: DvMF_1994 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_2374 null -136 4.7 GTCTTATACCTGATGCAATAT
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1994 null -65 5.4 ATCTTATATTTTTTGCAAGAC
DvMF_2004 null -56 6.3 GTCTTGCATAAGACATCATAC
DvMF_2006 null -57 6.3 GTCTTGCATAAGACATCATAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD