Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DvMF_2930 in Desulfovibrionales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog: DvMF_2930 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2930 null -59 6.3 TTTTGCATTCTGCATGCAAAA
DvMF_2925 null -54 5.6 TCGGGCATTGACGATGCAACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD