Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DvMF_1479 in Desulfovibrionales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Amino acid transport
Effector:
Regulog: DvMF_1479 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1483 null -93 6.4 CTTTGTATACGGTATGCAACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD