Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Chloroflexia

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0322 fmdB -52 5.5 AAATGATATATTATCTCAATA
Cagg_0608 yciC -79 5.8 TAATGATATAACGTATCATTT
Cagg_0608 yciC -20 4.5 AATCGAGATAAGGTATCAATG
Cagg_2028 COG0701 -74 5.8 TATTGACACACTGTATCAATA
Cagg_2024 zur -2 5.8 TAATGATCCATAGTATCATTA
Cagg_2043 znuA -35 5.9 AATTGAAACATAGTTTCATTA
Chloroflexus sp. Y-400-fl
Chy400_2148 znuA -35 6.1 TTTTGAAACAATGTTTCATTA
Roseiflexus castenholzii DSM 13941
Rcas_2945 yciC -58 4.3 CATTGATATACACTATCATCA
Rcas_1591 znuA -122 5.3 TATCCATACCACATATCAATA
Herpetosiphon aurantiacus ATCC 23779
Haur_2074 yciC2 -286 6.5 TAATGATATATTGTATCAATA
Haur_2300 Haur_2300 -80 6.5 TAATGATACTTTGTATCAATA
Haur_3793 null -34 6.1 TATTGATATCAAGTATCAATA
Haur_1311 null -47 5.9 TATTGATATAATATATCAGTA
Haur_4472 Rcas_3893 -20 6.3 TAATGATATATAGTATCAATA
Haur_2064 znuA -95 6.2 TAATGATACAAAATATCATTA
Haur_0639 yciC -42 6.3 TAATGATATATAGTATCAATA
Haur_2062 yciC3 -54 6.6 TATTGATATATTGTATCAATA
Haur_4472 Rcas_3893 -82 6.5 TAATGATACATTATATCAATA
Roseiflexus sp. RS-1
RoseRS_1258 znuA -124 5.5 TATAAAAACGAAGTATCAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD