Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FetR in Chloroflexia

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: FetR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Roseiflexus sp. RS-1
RoseRS_4469 RoseRS_4469 -141 6 TTATTAGGATATGCTAACCA
RoseRS_2294 fbpA -157 6 ATGTTAGAGTAATCTAACAA
RoseRS_3564 hmuV -109 6 TTATTAGACTATACTAACCA
Roseiflexus castenholzii DSM 13941
Rcas_4373 hmuV -123 5.9 TTATTAGACTATACTAACTT
Rcas_0821 RoseRS_4469 -98 6.3 TTATTAGCATATGCTAACAT
Rcas_3171 fbpA -159 5.5 ATGTTAGAGTAACCTAACAC
Chloroflexus sp. Y-400-fl
Chy400_2616 hmuV -57 5.8 AAATTAGAGTATTCTAATAG
Chy400_0349 fbpA -55 6.2 TTATTAGTGTATACTAATAA
Chy400_0344 COG0716 -158 6.2 TTATTAGCATATACTAACCT
Chy400_4135 Haur_0321 -136 5.8 TAATTAGCATACACTAACTA
Chy400_0685 RoseRS_4469 -92 5.8 TTATTAGAGTATGCTAACCG
Chloroflexus aggregans DSM 9485
Cagg_3308 hmuV -57 6 AAATTAGTATATTCTAACTT
Cagg_2416 fbpA -83 5.6 ACGTTAGCATATACTAACCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD