Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Chloroflexia

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_3553 mntA -38 6 ATTTTAGGTTAGGCTAAAAT
Cagg_1154 mntH -74 5.6 AATTTAGGGAATACTAAAAA
Chloroflexus sp. Y-400-fl
Chy400_0210 mntA -40 5.8 GATTTAGGTAAGGCTAAAAT
Roseiflexus castenholzii DSM 13941
Rcas_1724 mntA -55 5.9 ATTTTAGGATTTCCAAAATT
Rcas_3322 mntR -9 5.8 GTTTTAGGAATGCCTAAATA
Herpetosiphon aurantiacus ATCC 23779
Haur_4030 mntA -51 5.8 CTTTTAGGTATGCCTAAATA
Roseiflexus sp. RS-1
RoseRS_3070 mntA -42 5.6 GATTTAGGCAAGACAAAATT
RoseRS_4512 MntR2 -85 6.3 ATTTTAGGAATGCCTAAATT
RoseRS_3986 mntR -29 5.5 GTTTTAGGTCTACCTAAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD