Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Chloroflexia

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_2696 hrcA -55 7.6 TTAGCACTCTCGCCTCACGAGTGCTAA
Cagg_0489 groES -81 7.6 TTAGCACTCTTGAGTTAACAGTGCTAA
Cagg_0489 groES -154 6 TTAGCACTCAGTTTCGACGAGTGCTAA
Chloroflexus sp. Y-400-fl
Chy400_2238 hrcA -55 7.4 TTAGCACTCTCACCTCACGAGTGCTAA
Chy400_2961 groES -83 7.4 TTAGCACTCTCGACGTGACAGTGCTAA
Chy400_2961 groES -156 6 CTAGCAATCTCTAACGTCGAGTGCTAA
Roseiflexus castenholzii DSM 13941
Rcas_4390 hrcA -102 7.2 CTAGCACTCACCGGTCGAGAGTGCTAA
Rcas_1212 groES -72 7.7 TTAGCACTCTTTGGTCAAGAGTGCTAA
Rcas_1212 groES -145 6.4 CTGGCACTCTCATCTGGCGAGTGCTAA
Herpetosiphon aurantiacus ATCC 23779
Haur_0438 hrcA -40 7.3 TTAGCACTCCTCGGCCAAGAGTGCTAA
Haur_3678 groES -54 6.8 TTAGCACTCATCACAGTAGATTGCTAA
Haur_3678 groES -129 7.2 TTAGCACTCTCAACCCAAGAGTGATAA
Haur_3678 groES -231 6.2 TTAGCACTCTCGCCACGATTTTGCTAA
Roseiflexus sp. RS-1
RoseRS_3462 hrcA -190 7.1 CTAGCACTCAATAGTCGAGAGTGCTAA
RoseRS_4130 groES -75 7.8 TTAGCACTCTTCCGTCGAGAGTGCTAA
RoseRS_4130 groES -148 6.4 CTGGCACTCTTCCCTTTTGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD