Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Dbac_0104 in Desulfovibrionales

Properties
Regulator family: TetR
Regulation mode:
Biological process: Metabolite transport
Effector:
Regulog: Dbac_0104 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfomicrobium baculatum DSM 4028
Dbac_0103 acrA -54 6.1 AAGTGAACACTTGTTCACAT
Dbac_0104 null -28 5.9 AAGTGAACGATCGTTAACTA
Desulfovibrio magneticus RS-1
DMR_28390 null -26 5.3 TTGTGAACCGGTGTTAACTT
DMR_28400 null 32 5.7 AAGTGAACACGCGTTAACGC
Desulfovibrio salexigens DSM 2638
Desal_2340 null -42 5.3 AAGTTAAAGTGAATTCACAT
Desal_2340 null -36 5.5 AAGTGAATTCACATTCACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD