Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Clostridiaceae

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium difficile 630
CD1161 rplU -87 33 AATAATTGTAATGCCGCACAGTAAAGGTTTAAATCTTCAAATGAAGTACCTTGTACTGGCGAGTTTGAGGCCGAGGAG
Clostridium perfringens ATCC 13124
CPF_2385 rplU -89 27 GGCTTTTGTAAACCGCTCACGAATAGGTTTTAAAAATAACTTTAATTAGTTTACCTTAAGTGGCGAGACCGTTATGAGGA
Clostridium novyi NT
NT01CX_0081 rplU -89 22.5 GGCATTTGTAAACCGCACGCATAAGGTGAGAAATCTCAAAGTAATTTGAGTACCGACGGTGGCGAGACTCTTATAAGGA
Clostridium botulinum A str. ATCC 3502
CBO2989 rplU -85 32 GGCTTTTGTAGACCGCTCAGAAAAGGTGTTAAACATGATTTGCATGTACCTTAATTGGCGAGACTGGAATGAGGA
Clostridium acetobutylicum ATCC 824
CAC1257 rplU -90 28.8 CACATGTAGACCGCACAAAACGGGTTTTTATTAAACACAATTTATTGTGTACCCCTATTGGCGAGGCCGTAAATGAGG
Clostridium tetani E88
CTC02060 rplU -87 35.1 ATGGCATTTGTAAGCCGCACAGAAAAGGTTGAAAACATAATCTTATGTACCTTAATGGCGAGTCTGGATAGAGGA
Clostridium kluyveri DSM 555
CKL_0879 rplU -95 26.8 GACAGCTGTAGACCGCTCAAAAAAGGTTATGTAAATTATTTGGAAAGTTTTTCTAATATACCTTTTAGGCGAGACTGGATTGAGGAGG
Clostridium sp. OhILAs
Clos_1753 rplU -81 17.6 TATCTGTAGGTAGCCGCACAAATCGGGTTTAAAACGCAAGTACCTAGCATTTGGCGAGTTTGGGTCAGGGA
Clostridium bartlettii DSM 16795
CLOBAR_01486 rplU -89 27.7 TTAATAACTGTAATGCCGCACAGACAAGGTAAAAACTTTCGAAAGGAAGTACCTTAATGGCGAGTTTGAGACCGAGG
Clostridium butyricum 5521
CBY_4003 rplU -80 20.3 GCACACGTAAGGTTTTTAGTAAAACAAAGTCAAATCTTTGTACCAAAAGTGGCGAGACCG
Clostridium hiranonis DSM 13275
CLOHIR_01973 rplU -82 31.3 AATAACTGTAATGCCGCTCAGAAAAGGTTGAAAACCCAGTGGGTACCTTTAATGGCGAGTTTGTGACCGAGGAG
Clostridium leptum DSM 753
CLOLEP_02654 rplU -88 24.3 ATCATTGATAAGCCGCATATTGCGGGCTTTTTAAGCGAGCCTACGCTCCGCCTGACAGTAGCGAGTTCAAAAGAAGGTAG
Clostridium nexile DSM 1787
CLONEX_01673 rplU -73 26.4 CCGCACAATGAGGTTTGCAAGTTCTGCAATGCAGACACCGTAATTGGCGAGT
Clostridium scindens ATCC 35704
CLOSCI_00483 rplU -79 24.5 CCAGTATGCCGCACAATGAGGTATTAAAGTTCCCACAGGGACACCGTAATTGGCGAGTAATGATAATAGG
Clostridium sp. L2-50
CLOL250_00205 rplU -86 24.4 TACTAGTGTGCCGCACAGTGAGGTATAAGTTTGCATATTTTTATGCGACACCATAACTGGCGAGTTTGATTAAGGAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD