Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Clostridiaceae

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_1569 infC -104 42.8 ATGTTAAGAAGAAACAGCCGTTTCTCACCCTGCAGTGTTGAATTTACTAGTATGGGTTTTATGTGTGTCTATACATTGAGTATTGATAATTTGAGGCGGCAGTTATGCCGTCTTTTTATTATGTATAT
Clostridium difficile 630
CD0685 infC -163 31.9 AAACAAAGAAGAAGTCCGCTTCTCACCTTACGCCGGAGGTTAGTAAGGTAAATATAAGTTAAAGCTTAATTTTAATTTAA
Clostridium perfringens ATCC 13124
CPF_2146 infC -150 70.1 TGATGTCAAGAAGAAACAGCCGTTTCTCACCTTACAGCTATTAATGCTAGTTTGGTCATGAATTTTATTACATTTGATTTTGGTAATAGAGGACGGCTTAAAACCGTCCTTTTTTATTTAT
Clostridium novyi NT
NT01CX_1761 infC -316 61.8 TCGTTAAGAAGAAACTAAGCTGTTTCTCACCTTACAGCACAGCTAGTAAGGTTATACATTCATTTCAAGTTATTTTATTTTATGTGAATTGTATAGGACGGCTTAGAAGCCGTCCTTTTTATTTTGTAA
Clostridium botulinum A str. ATCC 3502
CBO3137 infC -162 54.1 TTTATGTAAGTAGAAACAGGCCGTTTCTCACCTTACAGCATGGCTAGTAAGGTTAGAGTATATAAATTTAATTTGTATTATTGTTTATGAAGACGGCTTATGCCGTCTTTTATTTATTATA
Clostridium acetobutylicum ATCC 824
CAC2361 infC -149 57.5 AGTATTGAAGAAGAAACTTGCCGTTTCTCACCTTACAGCAAAGCTAGTAAGGTTAAAGATATGCAGCTTATTTTGCTATGTATATTTGAGACGGTGAATAACCGTCTTTTTTTATTATA
Clostridium tetani E88
CTC02285 infC -126 66.4 AAACGTTAAGAAGAAACTAGCCGTTTCTCACCTTACAGCATAGCTAGTAAGGTTATGAAATCAGTTTATTATTTTGATTAGAGGACGGCATTTGCCGTCTTTTTTTATTTTA
Clostridium phytofermentans ISDg
null infC -218 26.5 ATAGCAAGTAGAGTATCCACTCTCACCCCAAGCAATAGGCGAACGGGTTACAATTTTCTTAAGTACACAATGATAGAACTAGGTTCTAAGATAGATTGTGTCGTTTATGAGATTTGAAAGTGGATAGCGTGCTATTCACTTTTTTTGTATGTTAA
Clostridium cellulolyticum H10
Ccel_1311 infC -220 41.7 AAAACAAGAAGAAGTCTTTCCACTTCTCACCTGTGCGGACAATGATTTGCCGGGTAAATATCGGTTTTGAACATATTTATATGTAATAGCTGAGATTTGAGATTATTAGTGGATACTTGCTTCTATCCACTTTTTTTATTGTTTAA
Clostridium kluyveri DSM 555
CKL_3195 rpmI -190 58.8 AAACGTTAAGAAGAAACAGCCGTTTCTCACCTTACAGCAAAGCTAGTAAGGTTGTGTTTATAAGAATTTTTTATTATAAAGATTCTTTGCTATGGGATGTATTTAAGAGCGGCTTTAGGCCGCTTTTTTTATGTGTA
Clostridium sp. OhILAs
Clos_1978 infC -271 35.6 GTAAACAAAGAAGAAGACATCCGCTTCTCACCTTAAAGCTCAGCTTAGTAAGGTCAATAATTTGATTGTATTTGTTGATAGGA
Clostridium bartlettii DSM 16795
CLOBAR_01302 infC -249 26 AACAGTAAAGAAGAAGTTCATTCTCACCTTGCGACGAAGGTTAGTAAGGTAAATATAAGTACAACTATCTATTTTATAAAT
Clostridium bolteae ATCC BAA-613
CLOBOL_05438 infC -240 16 GACAGGAAAGCAGGTATCCGCCTCACCCTGGCACGAACATGTGACCCGGGTTCATAGATGAAACGATGTGCTGTATTATTTCA
Clostridium hiranonis DSM 13275
CLOHIR_01892 infC -246 35.1 ACAGCAAGTAGAAATCCGTTTCTCACCTTACGACGAGAGTTAGTAAGTGTTAATATGAGTTAGAGAAGCTTTAGGTAAAAGCTTTATTAGTAATGAGAACTTATATGGCGGATGATAATTTATCATTCGCCTTTTTTAATATAATG
Clostridium leptum DSM 753
CLOLEP_03303 infC -79 34.5 TACAACAAAGCAGAGCAGTGTGTTCTCACCTGTGGGGTTTCGTCCGGCATGGGTCAATACAGGAAAGATACTTTCTTTCATGAGAGTTTTTAGGTGTATTGTGCGCGGACGGAGCATTCTGTCCGCGCTTTGTATTTTTC
Clostridium nexile DSM 1787
CLONEX_02671 infC -210 31.1 AAAAAGAAAGCAGAGTTCCACTCTCACCTTAGCACAAGTGGGTGACTAATGGTTGATATTGAAGCATAAAAATAGAATTTCTATTTTGTGTGCAGAAATGGAGTGGATAGCTGTGAGCTATTCATTTTTTTTACGCATC
Clostridium scindens ATCC 35704
CLOSCI_01277 infC -171 24.4 AAACAAAGTAGAGTATCCACTCTCACCATAGCACGATCGGGTGACTATTGGTCTGATATTGAGTATAAAGGCTCGTGAAGGGTCATTTTATGCGGGTATGCAAGTGGATAGTCTGTAAACTATTCACTTATTTTTATTTTATG
Clostridium sp. L2-50
CLOL250_00814 infC -156 50.7 CAAGAAAGCAGAGTATCCACTCTCACCTTAGCACGAAGAACAGTGACTCGGGTTCATATCTAAGTAGATTATAATATGTACTTATATATAATAGTGGATGGTTTGCGCTGTCCACTATTTTTTATGCAATG
Clostridium sp. SS2/1
CLOSS21_02197 infC -92 29.6 CAACAAAGAAGAGTATCCACTCTCACCTTAGCACATATGATAGATTAGGAAGTGACTTGGGTTAATATTTAAGAATATGATATTTCGTGATCATGCTTGAATTTTATGTGGATAGTCTTATAACTATCCACTTTTTTAATTATCATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD