Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L19_leader in Clostridiaceae

Properties
Regulator family: RF00556
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L19_leader - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_1180 rplS -64 27.3 GGGCGTTCCGCTGTCATACATATGTGTTAAGAACGTCAAAT
Clostridium difficile 630
CD1257 rplS -65 22.2 GGGCGTTCCTCTGTTTACACTGGTCGGGTAGTTAAGAACGTCTATG
Clostridium perfringens ATCC 13124
CPF_1962 rplS -71 31.7 ACCGGCGGTCCTCTGTCACAGAGTGTGTTAAGAACGTCAA
Clostridium novyi NT
NT01CX_2208 rplS -76 17.4 ACGGGCGGTCCTCTGTCTATAGTACACAATATACATAGAGTACGAACGTCAA
Clostridium botulinum A str. ATCC 3502
CBO2444 rplS -78 21.9 ACGGGCGGTCCTCTGCTTATATCATTTTATTACATAATTTAAGCAAGAACGTCAA
Clostridium acetobutylicum ATCC 824
CAC1759 rplS -61 23.4 AGGCGGTCCTCTGTCTTATATCTAGGCATGAACGTCAAAT
Clostridium tetani E88
CTC01252 rplS -48 21.3 GGGCGGTCCTCTGTTTATTGTAAGTAAATAAAGTATGAACGTCAAAT
Clostridium cellulolyticum H10
Ccel_0714 rplS -58 27.9 GGATGGTCCTCTGCACTTATGATGCACGAACATCTATG
Clostridium kluyveri DSM 555
CKL_1406 rplS -68 22.1 GGGCGTTCCTCTGTCTATGAATATTACAAGATAAGAACGTTTAAT
Clostridium sp. OhILAs
Clos_1468 rplS -57 18.6 GGACGTTCCTCTACAGGGCAGAGCGTATGAACGTCTAGA
Clostridium bartlettii DSM 16795
CLOBAR_02203 rplS -63 24.8 ACGGGCATTCCTCTGTTACACTGGTCAGTAATTAAGAATGTCTA
Clostridium butyricum 5521
CBY_0541 rplS -69 24.5 GGGCGTTCCTCTGTCTACATGAGAAACTGTGTTAAGAACGTCAAAT
Clostridium leptum DSM 753
CLOLEP_02366 rplS -51 20.4 TGACAGTCCTCTGCTTTACGCATGAATGTCTGAA
Clostridium nexile DSM 1787
CLONEX_03041 rplS -64 27.5 AGAGATGGTCCTCTGATACAGAATATGTATTAAGAACGTCCA
Clostridium scindens ATCC 35704
CLOSCI_01325 rplS -60 19.5 AGATGGTCCTCTAGTACGCATGTATTAAGAACATCCAAG
Clostridium sp. L2-50
CLOL250_00256 rplS -63 32.4 ATCGATGGTCCTCTGTACCGGTGTGGTAGTAAGAACATCTA
Clostridium sp. SS2/1
CLOSS21_02544 rplS 2 28.5 GGATGGTCCTCTGTTACATTTGGTATTAAGAACATCTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD