Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Chloroflexia

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_1474 rplJ -218 35.8 TAGTTTAATCTCTTAGCTGCCTGAGACAGCCGGTGAGCAGGTGCTCGTAATGCTCTATTGGGCACCGGCCGAGGTGGCGTCTGAGATGTGATAGGTGTGAGCAATGTGCTCGTTCTGTCAATAGTGTGCAGCATTTGCTGCGCCGTTCTCGGTCGCTTGGTCTCAGGATGCAAGCGACCGTTTTTTGTTGTATTT
Chloroflexus sp. Y-400-fl
Chy400_2356 rplJ -207 34.7 ATTTGCATCGTTAGCTGCCTGAGACAGTCGGTGAGCATTGCTCCTAATGGCCTGTGGGCCGCCGACCGAGGTGGCGTCTGAGATGAGATAGTCGTGAGTTGCTGACTCACTCTGTCGATAGTGCGCAGCTATGGCTGCGCTGTGCTCGGTCGCCTGTCTCAGAGACGGGCGACCGTTTTTGATCTGCTTTGA
Roseiflexus castenholzii DSM 13941
Rcas_4318 rplJ -163 33.9 ACAGGTGAATAGTCGAGCGCCGCAGACAGCGGGTGCGTGTGCTTAATGGCTGCGTGCCGCCCGCCGAGGCAGCTTCCTGAGACCATGCGATGCATGGGTTCGTGGGTTGCTGCGTTTGTGTGCGGCAACCCGCGTTTTTTATGGCGGAA
Roseiflexus sp. RS-1
RoseRS_3328 rplJ -159 55.2 GATATATATGCTAAGCGCCGCAGACAGCGGGTGCGTTTGCTTAATGGCTGCGTGCCGCCCGCCGAGGCAGCTTCCCAGGTCGATGCGACTGTAAGTTCGCGGGTTGCTGCGTCTGTGCGCGGCAACCCGCGTTTTTATCTTCCAGAAA
Herpetosiphon aurantiacus ATCC 23779
Haur_0140 rplJ -175 62.6 CGGTACAAGAAATACCACCGTAGACAGCAGGTGCGTTCGCGCTTAATGATGCCAAGCATCGCCCGCCGAGGTAGCTGATAGATTATTGCAATCTTCCACACATTTGTGTGCTACTGCCTCTGCGTGTCGTTACACTCAGGGCTTTTTTATTTGCCTGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD