Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Clostridiaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_0142 rplJ -158 72.4 AAAAGAAAATATTTTTTCCGTAGACAGTGGGTGCGAAAGCGTAAAGTATAACTGCCCGCCTAGGTATATAATAGATTGTATTATAGGCCTTCCATGTCTGCGGAAGGTCTTTTTTAATAAAAGAAG
Clostridium difficile 630
CD0063 rplJ -170 73.5 AAAAAAGAATAGATTTGCCGTAGATAGTGGGTGCGAGAGCTTAATATCCCGCCGAGGTTTTAGATAAATTGAGATTACTAAAGCTTTTGATGTCTACTTTTGGCAACAAAAGCTTTTTATAATGTTGCGG
Clostridium perfringens ATCC 13124
CPF_2724 rplJ -162 74.5 AAAAAGTGAATGAAAGTTTCCGTAGACAGTAGGTGCTGAAAGGCATAACGTAGAACAACCTACCGAGGGCAATTATAGTGTATATAATAGTCTTCCTATGTCTACGGGAAGACTTTTCTTATTATATA
Clostridium novyi NT
NT01CX_1105 rplJ -149 77.2 TTAAATAAGATAATACTCCGCAGACAGTAGGTGCGAAAGCATAACGGGGAACCAACCTACCGAGGATTTAGATATTCGGTATTTTGGATATATTAAGCCTCTTCGTGTCTGGGAAGAGGCTTTTAGTTTTTGTTAAG
Clostridium botulinum A str. ATCC 3502
CBO3490 rplJ -161 59.2 TGTAAAAATGAATATATCTCCGTAGACAGTGGGTGTTTTACATAATTAGTGAAAACTAAACCTACCTAGGAGTCCGATATAAAGTATATTGGGTCTCTCTGTCTTACGGAGAGACCTTTATTATTATAAAT
Clostridium acetobutylicum ATCC 824
CAC3146 rplJ -168 59.8 TATTAAATATGTAAATACTCCGTAGAAAGTAGGTGCGTGAGCGTAACGGATAACCAACCTACCGAGGATTCCAATATATATGAAAGTATATGGTCTCTTCGTACGTCTGCGGAGGGGCCTTTAGTTTATTATA
Clostridium tetani E88
CTC02610 rplJ -172 70.4 TAGAATTAAAGAAAATATACCGTAGACAGTAGGTGCATTTTGCATAACGGATTATCCAACCTACCGAGGGTTCCAATATATTACTTTTAGAGAGTATTGGTTTCTCCATGTCTACGGAGGAACCTTTAATTTTTTATAA
Clostridium phytofermentans ISDg
null rplJ -180 84.5 GCTTAATTCTCACAAACTGCCGAAGACAGTAGGTGCCGTAATGGCATAAGGTGAGACCGCCTACCGAGGAATAGATTAATCAAGCTAATATGCTAGACTAATAATCTGTCTCCTGTTTTCGCAGGAGGCAGTTTTTTTTATTCCGT
Clostridium cellulolyticum H10
Ccel_0310 rplJ -193 51 GGAAATTGAATATTGTGCCATAGACAGTAGGTGATAAGGTATTCTATACTTTAGTCATAATTGATGAAAATCATCCTACCGAGGTTTTATTAATAACGATTAATTACCCTTTGTATGTCTATGCACAAACAAAGGGTTTTTTATTTATATTTA
Clostridium kluyveri DSM 555
CKL_0214 rplJ -128 55.8 TTGAATAAGTATATTTTCCTTAGACAATAGGTGCAAAATGCGTAACGGTAAAACCAACCTATCCAGGATTCCAATATAAAGTAAAGGTGGTCTCTCTGTGTCTATAGGGAGGCTTTTGATTTTTATATAT
Clostridium sp. OhILAs
Clos_0482 rplJ -183 50.1 TAAAAATGAATATTTTGCCGTAGATAGTAGGTGCCTAAGCTTAAATATCCTACCGAGGCTTTGAATAAATAAAATCAAAGATCTCGTTATATCTATATATAGAAAAGATAGGGCGAGGTCTTATTTTAATTAATAAAA
Clostridium bartlettii DSM 16795
CLOBAR_00085 rplJ -161 75.1 AAAAACGAATAGATTTGCCGTAGACAGTAGGTGCGTAAGCTTAATTTCCTACCGAGGTTTTAGATAAATGAAACTAGAGCTTTTATGTCTACCATTGTGTTAGAAATAAAAGCTTTTTTAATTGTACGGT
Clostridium bolteae ATCC BAA-613
CLOBOL_06829 rplJ -334 66.2 ATACCACAGTATTGAATGCCCTGAGACAGCAGGTACCGTAAGGTGTAAGGCGAAAACGCCTGCCGAGGAACATACAAAACTCTGATTATTTATGATGAGATTTTGCGAACCTCTCTGTCTTTACGGCGGAGAGGTTTTTTGTCCGGTCT
Clostridium hiranonis DSM 13275
CLOHIR_01568 rplJ -169 80.9 AAAAAAGAATAGATTTGCCGTAGACAGTGGGTGCGTAAGCTTAATTTCCCGCCGAGGTTTTAGATATATTATTTAGAATGTTTAAGCCTCTGCGTCCGTCGATACAGAGGCTTTTTAAATGATACGGT
Clostridium leptum DSM 753
CLOLEP_02935 rplJ -129 64.8 ATATTTGCTGATCTTTTCCAAAGACAGCAGGTGCTTATTGCGTAAAGAGCTTATTGTTCTGCCTGCCGAGGAAGGTGACTTGCAAAGCCTGCATTTTTCTGTGTATGGTACTTTCAGGCCCTTTCCGGTATGCGGAAAGGGCCTTTTTACATCTCATTTT
Clostridium nexile DSM 1787
CLONEX_01917 rplJ -183 81.1 AACTTATATTAGAAAACTGCCGAAGACAGTAGGTGCCGTAAGGCATAAGTAGTGAACGCCTACCGAGGAGATTTGAATTCGATGAATTATGTGAATTTACTGTCCTCTTGTCGTGTGGCGAGAGGATTTTTTATCTTTATT
Clostridium scindens ATCC 35704
CLOSCI_00863 rplJ -189 73.2 TAATATTTCACGATGACTGCCGAAGACAGCAGGTGCGTAAGCGTAAGTAGACAAACGCCTGCCGAGGAAAGTTGGATTCTGTTATTATGAATTACAATGCCTCTATGTCTTTGGATATAGAGGCTTTTTAGCGTATAGC
Clostridium sp. L2-50
CLOL250_01641 rplJ -192 85 TATCCCCCGATGAACTGCCGAAGACAGTAGGTGCCGGATGGCATAAGTTGAAAAACACCTACCGAGGAATATATCGTTAATATTATTTTAACTATATGCTCTCTGTCTTATCGACAGAGAGCTTTTCTTATTTTAGCAG
Clostridium sp. SS2/1
CLOSS21_02766 rplJ -175 79.5 TATGTAAAGTATTACTGCCGAAGACAGCAGGTGCCGCAAGGCGCAACGTAGAACAACCTGCCGAGGAGAGTATTAGTGAATATGCTAATTAACACTCTATGTCTGTGCGGATATAGAGTTTTCTTTTTATATGTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD